added bibliography, small edits elsewhere

README.md

@@ -55,26 +55,27 @@ Then, copy or move "scythe" to a directory in your $PATH.
 
 Scythe can be run minimally with:
 
-    scythe -a adapter_file.fasta -o trimmed_sequences.fasta sequences.fastq
+    scythe -a adap.fa -o trimmed_sequences.fasta sequences.fastq
 
-By default, the prior contamination rate is 0.05. This can be changed
+By default, the prior contamination rate is 0.3. This can be changed
 (and one is encouraged to do so!) with:
 
-    scythe -a adapter_file.fasta -p 0.1 -o trimmed_sequences.fastq sequences.fastq
+    scythe -a adap.fa -p 0.1 -o trimmed_sequences.fastq sequences.fastq
 
 If you'd like to use standard out, it is recommended you use the
 --quiet option:
 
-    scythe -a adapter_file.fasta --quiet sequences.fastq > trimmed_sequences.fastq
+    scythe -a adap.fa --quiet sequences.fastq > trimmed_sequences.fastq
 
 Also, more detailed output about matches can be obtained with:
 
-    scythe -a adapter_file.fasta -o trimmed_sequences.fasta -m matches.txt sequences.fastq
+    scythe -a adap.fa -o trimmed_sequences.fasta -m matches.txt sequences.fastq
 
-By default, Illumina's quality scheme (pipeline > 1.3) is used. Sanger
-or Solexa (pipeline < 1.3) qualities can be specified with -q:
+By default, the Sanger fastq quality encoding (phred+33; pipeline >= 1.8) is used. 
+Illumina (phred+64; pipelines 1.3 - 1.7) or Solexa ("Solexa"+64; pipelines < 1.3) 
+qualities can be specified with -q:
 
-    scythe -a adapter_file.fasta -q solexa -o trimmed_sequences.fasta sequences.fastq
+    scythe -a adap.fa -q solexa -o trimmed_sequences.fasta sequences.fastq
 
 Lastly, a minimum match length argument can be specified with -n <integer>:
 
@@ -86,27 +87,21 @@ liberal trimming, i.e. of only a few bases.
 
 ## Notes
 
-Note that the two provided adapter sequence files contain non-FASTA
-characters to denote the locations of barcode sequences, which always
-appear in TruSeq adapters, and may or may not appear in forward and/or
-reverse reads using the original Solexa/Illumina adapter sequences,
-depending on library preparation. You'll need to modify the adapter
-sequence files in order to use them.
-
-In the case of the original Solexa/Illumina adapter sequences, we've seen
-barcodes "upstream" of forward reads (in which case the reverse complement
-of the barcode will appear before the adapter sequence at the 3'-end of 
-reverse reads - replacing the [NNNNNN]). We've also seen barcodes upstream 
-of reverse reads (in which case the reverse complement of the barcode will 
-appear before the adapter sequence at the 3'-end of forward reads - 
-replacing the [MMMMMM]). Your definition of the barcode may be someone
-else's reverse-complemented barcode, and the barcode may or may not be 6
-bases.
-
-In the case of TruSeq adapter sequences, there will always be a 6 bp
-barcode in place of the [NNNNNN] in sequence contaminating forward reads
-(if the fragment is short enough, of course). This barcode sequence should
-match the barcode included in the reads' FASTQ headers.
+Note that the provided adapter sequence files (*_adapters.fa) contain
+non-FASTA characters to denote the locations of barcode sequences,
+which always appear in TruSeq adapters, and may or may not appear in
+forward and/or reverse reads using the original ("Solexa") Illumina
+adapter sequences, depending on library preparation. You'll need to
+modify the adapter sequence files in order to use them.
+
+An example adapters file (adap.fa) is included for ease of use. It
+omits barcodes, so it can be used on all samples of an indexed pool or
+set of files (the first ~30 bp are sufficient to identify adapter
+contamination). However, Scythe will check reads against all adapter
+sequences in the file, so a file with 6 adapter sequences will cause
+roughly 6x runtime. Since your samples will never include adapters
+from several types of kits, you're encouraged to omit everything but
+the adapter(s) that will be found in your sequences.
 
 Scythe only checks for 3'-end contaminants, up to the adapter's length
 into the 3'-end. For reads with contamination in *any* position, the
@@ -138,9 +133,9 @@ Scythe adapter files that contain all possible barcodes concatenated
 with possible adapters, so that both can be recognized and
 removed. This has worked well and is recommended for cases when 3'-end
 quality deteriorates and prevents barcode removal. Newer Illumina
-chemistry has the barcode separated from the fragment, so that it
-appears as an entirely separate read and is used to demultiplex sample
-reads by Illumina's CASAVA pipeline.
+chemistry (TruSeq) has the barcode separated from the fragment, so
+that it appears as an entirely separate read that is used to
+demultiplex sample reads by the Illumina pipeline.
 
 ### Does Scythe work on 5'-end or other contaminants?
 

adap.fa

@@ -0,0 +1,16 @@
+>TruSeq_forward_contam
+AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
+>TruSeq_reverse_contam
+AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
+>Nextera_forward_contam
+CTGTCTCTTATACACATCTCCGAGCCCACGAGAC
+>Nextera_reverse_contam
+CTGTCTCTTATACACATCTGACGCTGCCGACGA
+>TruSeq_SmallRNA_forward_contam
+TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC
+>TruSeq_SmallRNA_reverse_contam
+GATCGTCGGACTGTAGAACTCTGAACCTGTCG
+>Solexa_forward_contam
+AGATCGGAAGAGCGGTTCAGCAGGAATGCCGA
+>Solexa_reverse_contam
+AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG

nextera_adapters.fa

@@ -0,0 +1,4 @@
+>Nextera_forward_contam
+CTGTCTCTTATACACATCTCCGAGCCCACGAGAC[8bp index]ATCTCGTATGCCGTCTTCTGCTTG
+>Nextera_reverse_contam
+CTGTCTCTTATACACATCTGACGCTGCCGACGA[8bp index]GTGTAGATCTCGGTGGTCGCCGTATCATT