The goal of lampshade is to manipulate and visualise short DNA sequences and associated LAMP primers
You can install the released version of lampshade from CRAN with:
install.packages("lampshade") # doesn't currently existAnd the development version from GitHub with:
# install.packages("devtools")
devtools::install_github("moshejasper/lampshade")Here we create a simple DNA container object
library(lampshade)
## basic example code
dframe <- dna_frame(random_sequence_generator(500))
dframe
#> $seqdata
#> # A tibble: 500 x 3
#> position fwd cmp
#> <dbl> <chr> <chr>
#> 1 1 w w
#> 2 2 c g
#> 3 3 a t
#> 4 4 m k
#> 5 5 k m
#> 6 6 a t
#> 7 7 g c
#> 8 8 t a
#> 9 9 g c
#> 10 10 c g
#> # ... with 490 more rows
#>
#> $fprimers
#> NULL
#>
#> $rcprimers
#> NULL
#>
#> $rprimers
#> NULL
#>
#> $cprimers
#> NULLNow, we are going to visualise this object as double-stranded DNA (mapped to a5 size)
simple_dnagraph_double(dframe, family = "serif")
Next, we are going to use a custom DNA visualising font - a simple
monochromatic font based on the ambiscript mosaic font described at
https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-52.
First, we need to change our system settings to enable non-standard
fonts, as we are going to be using a custom DNA font family. This change
will temporarily give graphing control to a 3rd party program using the
dnagraph_setup() command. We will restore control later using the
dnagraph_detach() command. This process is optional, but needed if we
wish to use the custom DNAMosaic font.
dnagraph_setup()Now, we generate the graph using the custom DNA font, & the layout for a singlestranded view. The single-stranded view works well with the DNAMosaic font, as a 180 rotation of the sense yields the antisense strand.
simple_dnagraph_single(dframe, family = "DNAMosaic")
dnagraph_detach()In this section, we are going to load primer sequences based on a wAlbB assay developed for mosquitoes (see https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0225321 for source).
wspseq <- "TGCCTATCACTCCATACGTTGGTGTTGGTGTTGGTGCAGCATATATCAGCAATCCTTCAGAAGCTAGTGCAGTTAAAGATCAAAAAGGATTTGGTTTTGCTTATCAAGCAAAAGCTGGTGTTAGTTATGATGTAACCCCAGAAATCAAGCTTTATGCTGGTGCTCGTTATTTTGGTTCTTATGGTGCTAGTTTTAATAAAGAAACAGTATCAGCTACTAAAG"
wf3 <- "TGCCTATCACTCCATACGT"
wb3 <- "CTTTAGTAGCTGATACTGTTTCT"
wlb <- "CCAGAAATCAAGCTTTATGCTGGTG"
wlf <- "CTTTAACTGCACTAGCTTCTGAAGG"
wf1c <- "TGCTTGATAAGCAAAACCAAATCC"
wf2 <- "TGGTGCAGCATATATCAGCAA"
wb1c <- "AGCTGGTGTTAGTTATGATGTAACC"
wb2 <- "CACCATAAGAACCAAAATAACGAG"Now, we input them into a lamp primer list object
wsp_lamp <- lamp_frame(wspseq, wf3, wf2, wf1c, wb1c, wb2, wb3, wlf, wlb)
wsp_lamp
#> $seqdata
#> # A tibble: 222 x 3
#> position fwd cmp
#> <dbl> <chr> <chr>
#> 1 1 t a
#> 2 2 g c
#> 3 3 c g
#> 4 4 c g
#> 5 5 t a
#> 6 6 a t
#> 7 7 t a
#> 8 8 c g
#> 9 9 a t
#> 10 10 c g
#> # ... with 212 more rows
#>
#> $fprimers
#> [1] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
#> [20] 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
#> [39] 51 52 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129
#> [58] 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148
#> [77] 149 150 151 152 153 154 155 156 157 158 159 160 161 162
#>
#> $rcprimers
#> [1] 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218
#> [20] 219 220 221 222 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177
#> [39] 178 179 180 181 182 183 184 185 186 87 88 89 90 91 92 93 94 95 96
#> [58] 97 98 99 100 101 102 103 104 105 106 107 108 109 110 54 55 56 57 58
#> [77] 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77
#> [96] 78
#>
#> $rprimers
#> NULL
#>
#> $cprimers
#> NULL
#>
#> $f3
#> [1] "TGCCTATCACTCCATACGT"
#>
#> $f2
#> [1] "TGGTGCAGCATATATCAGCAA"
#>
#> $f1c
#> [1] "TGCTTGATAAGCAAAACCAAATCC"
#>
#> $b1c
#> [1] "AGCTGGTGTTAGTTATGATGTAACC"
#>
#> $b2
#> [1] "CACCATAAGAACCAAAATAACGAG"
#>
#> $b3
#> [1] "CTTTAGTAGCTGATACTGTTTCT"
#>
#> $lf
#> [1] "CTTTAACTGCACTAGCTTCTGAAGG"
#>
#> $lb
#> [1] "CCAGAAATCAAGCTTTATGCTGGTG"
#>
#> $f3pos
#> [1] 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
#>
#> $f2pos
#> [1] 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52
#>
#> $f1cpos
#> [1] 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105
#> [20] 106 107 108 109 110
#>
#> $b1cpos
#> [1] 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131
#> [20] 132 133 134 135 136 137
#>
#> $b2pos
#> [1] 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181
#> [20] 182 183 184 185 186
#>
#> $b3pos
#> [1] 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218
#> [20] 219 220 221 222
#>
#> $lfpos
#> [1] 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78
#>
#> $lbpos
#> [1] 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156
#> [20] 157 158 159 160 161 162Next, we visualise this reaction first as ssDNA in normal fonts
lamp_dnagraph_single(wsp_lamp, family = "serif")
#> [1] 0.9504808
#> [1] 0.2411058
Finally, we visualise this reaction using the DNAMosaic script:
dnagraph_setup()
lamp_dnagraph_single(wsp_lamp, family = "DNAMosaic")
#> [1] 0.9504808
#> [1] 0.2411058
dnagraph_detach()Note that with ambiscript, orientation is very important. Lines with arrows show single stranded DNA primer direction. To convert, the sequence should be read as if the line is ON TOP. (i.e. rotate so primer line is on top, then read left to right. rotate f1c & b1c sequences in line wiht the connecting arrow to produce the FIP & BIP primers.)
Primer Explorer v5 PrimerInfo files can be loaded with the command
pe_load_primerinfo() attaching the filepath. This produces a LampFrame
object that can be graphed as above.
Moshe Jasper October 4, 2021