Software implementation of SparseRNAFolD.
SparseRNAFolD is a time- and space-efficient sparsified minimum free energy folding of pseudoknot-free RNAs
Linux, macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++17 features.
Usage: SparseRNAFolD[options] [input sequence]
Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm.
-h, --help Print help and exit
-V, --version Print version and exit
-v, --verbose Turn on verbose output
-m, --mark-candidates Represent candidate base pairs by square brackets
-r, --input-structure Give a restricted structure as an input structure
-d, --dangles=INT How to treat \"dangling end\" energies for bases adjacent to helices in free ends and multi-loops (default=`2')
-P, --paramFile Read energy parameters from paramfile, instead of using the default parameter set.
--noGC Turn off garbage collection and related overhead
Remarks: The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like
assume you are in the SparseRNAFolD directory
./build/src/SparseRNAFolD GGGGAAAACCCC
./build/src/SparseRNAFolD GGGGAAAACCCC -r "((........))" -d1
./build/src/SparseRNAFolD -m -v UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA
UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA
.[[(((..(..[((.[[[([[[...]]])]]].))]...)..)))]].... (-6.00)
TA cnt:165
TA max:167
TA av:167
TA rm:6
Can num:109
Can cap:118
TAs num:165
TAs cap:169
Results can be found at https://github.com/mateog4712/SparseRNAFolD-RawData
For questions, you can email mateo2@ualberta.ca