Spark

Description:

Software implementation of Spark.
Spark is a time- and space-efficient sparsified minimum free energy folding of possibly-pseudoknotted RNAs

Supported OS:

Linux, macOS

Installation:

Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.

CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.

Linux instructions source

Steps for installation

1. Download the repository and extract the files onto your system.
2. From a command line in the root directory (where this README.md is) run

cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++17 features.

Help

Usage: Spark[options] [-r "input structure"] [input sequence]

Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm.

  -h, --help             Print help and exit
  -V, --version          Print version and exit
  -v, --verbose          Turn on verbose output
  -m, --mark-candidates  Represent candidate base pairs by curly brackets
  -r, --input-structure  Give a restricted structure as an input structure (required for pseudoknots)
  -i, --input-file       Give a path to an input file containing the sequence (and input structure if known)
  -p, --pseudoknot-free  Turn off pseudoknot prediction
  -k, --pk-only          Only add base pairs which cross the constraint structure. The constraint structure is returned if there are no energetically favorable crossing base pairs
  -d, --dangles=INT      How to treat \"dangling end\" energies for bases adjacent to helices in free ends and multi-loops (default=`2')
  -P, --paramFile        Read energy parameters from paramfile, instead of using the default parameter set.
      --noGC             Turn off garbage collection and related overhead
      --noGU             Turn off Wobble base pairing
      --noConv           Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA

Remarks: The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like

Example:

assume you are in the Spark directory
./build/src/Spark GGGGAAAACCCC
./build/src/Spark -d1 -r "((........))" GGGGAAAACCCC
./build/src/Spark -d1 -P "params/rna_Turner04.par" -r "((........))" GGGGAAAACCCC
./build/src/Spark -i input.txt

./build/Spark -m -v -r "...............(((((((...)))))))..................." UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA

UAACUUAGGGGUUAAAGUUGCAGAUUGUGGCUCUGAAAACACGGGUUCGAA
{{{({....})}}}.((((((([[[)))))))............]]].... (-7.95)

TA cnt: 63
TA max: 63
TA av:  61
TA rm:  3

Can num:        47
Can cap:        52
TAs num:        63
TAs cap:        64

Psuedoknotted

TAs num:        1
TAs cap:        1
TA av:  5
TA rm:  0

WMB Can num:    6
WMB Can cap:    7
VP Can num:     25
VP Can cap:     25
BE Can num:     7
BE Can cap:     7

Results

Results can be found at https://github.com/mateog4712/Spark-RawData

Questions

For questions, you can email mateo2@ualberta.ca