Skip to content

mateog4712/KnotAli

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

86 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

KnotAli

https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-022-04673-3

Description:

Software implementation of KnotAli.
KnotAli is an algorithm for predicting the pseudoknotted secondary structures of RNA using relaxed Hierarchical Folding.

Supported OS:

Linux, macOS

Installation:

Requirements: A compiler that supports C++20 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.8 or greater.

CMake version 3.8 or greater must be installed in a way that KnotAli can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.8, you will have to install CMake depending on your operating system.

For issues with OpenSSL, installing libssl-dev can fix it, e.g. In Ubuntu, sudo apt-get install libssl-dev

Linux instructions source

Steps for installation

  1. Download the repository and extract the files onto your system.
  2. From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++11 features.

After installing you can move the executables wherever you wish, but you should not delete or move the simfold folder, or you must recompile the executables. If you move the folders and wish to recompile, you should first delete the created "build" folder before recompiling.

Help

Usage: KnotAli[options] [input file]

Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm for each sequence in the alignment.

  -h, --help             Print help and exit
  -V, --version          Print version and exit
  -v, --verbose          Turn on verbose
  -i, --input-type       Specify input file type (CLUSTAL, FASTA, or Stockholm, base is FASTA)
  -o, --output-file      Specify output file
  -d  --dangles          Specify the dangle model to be used (base is 2)
  -P, --paramFile        Read energy parameters from paramfile, instead of using the default parameter set.

Remarks: The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like

Example:

assume you are in the KnotAli directory
./build/src/KnotAli myinputfile.txt
./build/src/KnotAli -o outputfile.txt myinputfile.afa
./build/src/KnotAli -p "params/rna_Turner04.par" -d1 example/align_ex1.fa


Let's go through an example from the example folder: align_ex1.fa. The first three sequences from this file are:

>tRNA_tdbR00000184-Asterias_amurensis-7602-Lys-CUU
--CUUUGAUAAGCUUAUAAUGGCA-AGCAUUAAACUCUUAAUUUAAAUCAAAGUGAUCUCACCACACUAUCAAAGACCA
>tRNA_tdbR00000189-Rattus_norvegicus-10116-Lys-NUU
------CAUUGCGAAGC----UUAGAGCGUUAACCUUUUAAGUUAAAGUUAGAGACAACAAAUCUCCACAAUG--ACCA
>tRNA_tdbR00000190-Bos_taurus-9913-Lys-NUU
-CACUAAGAAGC--------UAUAUAGCACUAACCUUUUAAGUUAGAGAUUGAGAGCCAUAUACUCUCCUUGGUGACCA

_(((((((___((____________))__(((((_x_____)))))_____((((_________)))))))))))_xxx (consensus structure)

The consensus structure shown above is the result of the covariation portion of the algorithm. The '_' represents nucleotides that are allowed to pair 
in the final step. In contrast 'x' represents nucleotides which the covariation deemed unlikely to pair and thus are restricted from pairing. 
Each '(' and ')' an opening and closing base pair within the structure. The consensus can be seen when using the -v (verbose) command.

After running KnotAli, you will have your output file (in the case of our example: align_sol1.txt) in the format of 

line 1: Sequence name
line 2: Sequence
line 3: Output Structure
line 4: Output Energy

We give the first three sequences from prior in this format after running: 

>tRNA_tdbR00000184-Asterias_amurensis-7602-Lys-CUU
CUUUGAUAAGCUUAUAAUGGCAAGCAUUAAACUCUUAAUUUAAAUCAAAGUGAUCUCACCACACUAUCAAAGACCA
.((.(....[[[......]]].....(((((.......))))).....((((.........)))).).))......
0.53

>tRNA_tdbR00000189-Rattus_norvegicus-10116-Lys-NUU
CAUUGCGAAGCUUAGAGCGUUAACCUUUUAAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA
[[[[[.[..[[[...]]]........(((((.......))))).............].]]]]]....
-2.38

>tRNA_tdbR00000190-Bos_taurus-9913-Lys-NUU
CACUAAGAAGCUAUAUAGCACUAACCUUUUAAGUUAGAGAUUGAGAGCCAUAUACUCUCCUUGGUGACCA
(((((((..[([....])].(((((.......))))).....(((([.......])))))))))))....
-11.61

For each sequence, KnotAli gives the minimum free energy and structure given the restricted structure found in the covariation step.

Example Info:

The three examples were aligned using the MUSCLE software (doi:10.1186/1471-2105-5-113). The first example: align_ex1.fa was compiled of 100 tRNA sequences 
in FASTA format. The results of running KnotAli on this example can also be found in align_sol1.txt. 
align_ex2.fa, also in FASTA format, is comprised of 100 RNaseP sequences and its structures are found in align_sol2.txt. 
align_ex3.aln is an example file in CLUSTAL format. It was comprised of 100 SRP sequences, and its structure can found in align_sol3.txt
Lastly, align_ex4.stockholm is an example file in stockholm format. It was comprised of 954 tRNA, and its structur can be found in align_sol4.txt. Align_sol4.txt was ran with -p input parameter which turns off pseudoknot prediction.
References:
Robert C. Edgar. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 5:113, Aug 2004

Changes

08/02/2024 KnotAli has been updated to use the new version of Iterative-HFold. As such, it should be much faster to run compared to before. The change includes a change to the Vienna RNA
format from the simfold formate to improve interoperability

About

No description, website, or topics provided.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published

Languages