-
First, rename all the genome .fasta files to their sequence name from the first line of the .fasta file by running the rename.sh script.
-
Second, Some preprocessing on the TryTrypDB_Aug2017_alltRNAs.tfam.fas file to remove the even lines (which is the gene sequence and is repeated in "araquery" field) using the fallowing code:
awk '{if(NR%2==1){print $0}}' TryTrypDB_Aug2017_alltRNAs.tfam.fas > temp.txt
- Then, remove lines that do not have the sourceorganism field. (we will deal with these files later!)
awk '{for(i=1; i < NF; i++){if(match($i,"sourceorganism*")){print $0; break;}}}' temp.txt > inputgenefile.txt
- Third, read the TryTrypDB_Aug2017_alltRNAs.tfam.fas file line by line, take each gene, and using blast align it to its source organism genome. Then, make an output.txt file like the example shown bellow using alignseq.sh script.
Blechomonas_ayalai_B08-376|ggggatgtagctcaaatggtagagcgaccgcttagcatgcggtaggtattgggatcgatacccaacttctccatc|3 hits
212366 212440
133 205
1008 968
- Finally, using this output.txt file and leishmania.R script we can get the fallowing diagrams to see how the data looks like.
-
Frequency of identical genes (same organism, same color)
-
Frequency of GeneOrganism. To see how many repeats of same gene with same source organism we have in the data. (same organism, same color)
-
Frequency of GeneOrganism. To see how many repeats of same gene with same source organism we have in the data. (same gene, same color)
-
Genes VS. Number of hits (same organism same colour )
