-------------------------------------------------------------------------
 KBWS - KEIO Bioinformatics Web Service - EMBASSY package ver. 1.0.9

                              Web home: http://www.g-language.org/kbws/

    All rights reserved. Copyright (C) 2010 by OSHITA Kazuki.

    This EMBASSY package is free software for non-commercial and
    education use only (limited due to wsdl2h); you can redistribute it
    and/or modify it under the terms of the GNU General Public License as
    published by the Free Software Foundation, version 2 of the License
    expect commercial use.

    See also GNU General Public License Version 2, included in this
    package as COPYING.
-------------------------------------------------------------------------


[ About ]----------------------------------------------------------------
   This is an EMBASSY package for the utilization of bioinformatics web
   servcie.

   All of the tools included in this package are wrapper programs to
   utilize KBWS SOAP services, which are web APIs to access numerous
   bioinformatics web services under unified interface with SOAP 1.1.

   Detailed documentation about KBWS SOAP services are available at
   http://www.g-language.org/kbws/.
-------------------------------------------------------------------------


[ Installation ]---------------------------------------------------------

REQUIREMENT
  EMBOSS (> 6.6.0) - This EMBASSY package requires EMBOSS version 6.6.0 or
  above.

INSTALLATION
  In the following examples, we assume downloaded EMBOSS filename is
  EMBOSS-latest.tar.gz (EMBOSS-6.6.0)

  1. Download and compile EMBOSS source code
     % wget ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz
      (or "curl -O ftp://emboss.open-bio.org/pub/EMBOSS/emboss-latest.tar.gz")
     % tar xzf EMBOSS-latest.tar.gz
     % cd EMBOSS-6.6.0
     % ./configure
     % make
     % sudo make install

  2. Make new directory "embassy" (in EMBOSS-6.6.0/ directory) if it does
     not exist already
     % mkdir embassy

  3. Go into that directory
     % cd embassy

  4. Place KBWS file in current directory
     % wget http://www.g-language.org/kbws/source/KBWS-1.0.9.tar.gz
      (or "curl -O http://www.g-language.org/kbws/source/KBWS-1.0.0.tar.gz")

  5. Uncompress the KBWS tarball package, and go into the new KBWS directory
     % tar xzf KBWS-1.0.9.tar.gz
     % cd KBWS-1.0.9
     ( EMBOSS-6.6.0/embassy/KBWS-1.0.9 )

  6. Configure and compile
    % ./configure (use same options as you used to compile emboss)
    % make
    % sudo make install

NOTE
  libtool problem
    On some systems there may be compatibility problems with different
    automake, autoconf or libtool versions. If a libtool problem
    arises you can try deleting the following files:

      config.cache
      ltmain.sh
      ltconfig
      libtool

    and then type

      % aclocal -I m4
      % autoconf
      % automake -a

    and then retry make.

  Update of EMBOSS
    When users are upgrading EMBOSS, please be sure to uninstall old version
    of EMBOSS and KBWS. If you override them, some older version of files
    may cause errors.

  EMBOSS is already installed
    When EMBOSS is already installed in your system, please install KBWS at
    the same PATH as existed EMBOSS by '--prefix' option.

  Non-root users (using '--prefix' option)
    If you use './configure' command with '--prefix' option, please rewrite
    'emboss_acdroot' and 'emboss_data' value in ~/.embossrc file. Please check
    '~/.embossrc' file for further informations.
-------------------------------------------------------------------------


[QuickStart]-------------------------------------------------------------

DATABASE DEFINITION
   The database definitions for following commands are available at
   "KBWS-1.0.9/data/embossrc-template". 

   The latest version is available at following URL:
   http://soap.g-language.org/kbws/embossrc

INFORMATION OF KBWS TOOLS
  List of all tools
    If you want to get list of all tools included in KBWS, you can try
    the below command.

      % wossname -showembassy KBWS

  Documentation
    You can view available documentations with "tfm" utility included in
    EMBOSS.

      % tfm kblast # example for "kblast"

USAGE EXAMPLE
   Sample files used in this section are available from EMBOSS package.
     ( EMBOSS-6.6.0/test/data/* )

  1. kblast (BLAST)
      % kblast swissprot:FOXP2_HUMAN -database swissprot -format 8 -eval 1e-100
      Search similar sequences in public repositories using BLAST
      Output file [foxp2_human.kblast]:

      % cat foxp2_human.kblast
      query	sp|Q8MJ98.3|FOXP2_PONPY	99	457	1	0	240	697	238	695	0.0	2005
      query	sp|Q5QL03.1|FOXP2_HYLLA	99	457	1	0	240	697	238	695	0.0	2005
      query	sp|Q8MJ99.1|FOXP2_GORGO	99	457	1	0	240	697	238	695	0.0	2005
      query	sp|Q8MJA0.1|FOXP2_PANTR	99	457	1	0	240	697	241	698	0.0	2005
      query	sp|P58463.2|FOXP2_MOUSE	99	457	1	0	240	697	239	696	0.0	2005
      query	sp|Q8MJ97.1|FOXP2_MACMU	99	457	1	0	240	697	239	696	0.0	2005
      query	sp|O15409.2|FOXP2_HUMAN	100	458	0	0	240	697	240	697	0.0	2005
      query	sp|P0CF24.1|FOXP2_RAT	99	456	2	0	240	697	235	692	0.0	2000
      query	sp|Q4VYS1.1|FOXP2_XENLA	95	450	8	0	240	697	231	688	0.0	1948
      query	sp|Q5W1J5.1|FOXP1_XENLA	68	373	87	6	240	697	105	560	8e-148	1350
      query	sp|A4IFD2.1|FOXP1_BOVIN	66	371	89	6	240	697	201	656	4e-146	1335
      query	sp|Q9H334.1|FOXP1_HUMAN	66	372	89	7	240	697	203	659	2e-144	1321
      query	sp|Q498D1.1|FOXP1_RAT	65	371	90	7	240	697	237	693	9e-144	1315
      query	sp|P58462.1|FOXP1_MOUSE	65	372	89	7	240	697	231	687	1e-143	1314
      query	sp|Q58NQ4.1|FOXP1_CHICK	65	369	92	7	240	697	212	668	1e-143	1313
      query	sp|Q8IVH2.1|FOXP4_HUMAN	60	332	119	5	240	686	201	650	6e-131	1204
      query	sp|Q9DBY0.1|FOXP4_MOUSE	60	332	118	17	240	686	207	642	2e-126	1166
      query	sp|Q4VYR7.1|FOXP4_XENLA	58	336	120	20	241	696	187	622	6e-126	1161

  2. kcentroidfold (Centroid Fold)
      % kcentroidfold
      RNA 2D structure prediction from an RNA sequence using CentroidFold
      Input (gapped) sequence(s): dna.fasta
      Output image file name [kcentroidfold.png]:
      Output file [fasta.centroidfold]:

      % cat fasta.centroidfold
      >FASTA
      ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
      ((((((((((((((((((((((((((((((((((((((((((((((((....))))))))))))))))))))))))))))))))))))))))))))))))

      % ls kcentroidfold.png
      kcentroidfold.png

  3. kweblogo (WebLogo)
      % kweblogo dna.m-fasta -filename kweblogo.png
      make the generation of sequence logos using WebLogo
      Output file name [kweblogo.png]:

      % ls kweblogo.png
      kweblogo.png

SAMPLE DATA
    You can use sample data included in EMBOSS.
    Please check test/ directory in EMBOSS package.
-------------------------------------------------------------------------

[ Content ]--------------------------------------------------------------
 gSOAP Toolkit
   This EMBASSY package is depended on gSOAP Toolkit to use SOAP
   transfer, which is included in gsoap/ directory and automatically used
   during compilation.
-------------------------------------------------------------------------

[Contact]----------------------------------------------------------------
  Kazuki Oshita < cory@g-language.org >
    Institute for Advanced Biosciences, Keio University.
-------------------------------------------------------------------------