Skip to content

chaigsh/MECAT2

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

10 Commits
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Contents

Introduction

MECAT2 is an improved version of MECAT. It is an ultra-fast and accurate Mapping, Error Correction and de novo Assembly Tools for single molecula sequencing (SMRT) reads. MECAT2 powers following improvements over MECAT:

  • All modules in MECAT2 are developed by ourselves for easy maintenance.
  • MECAT2 can be parallel to multiple nodes.
  • Many bugs in MECAT have been fixed.
  • To improve the mapping efficiency, the default length of kmers is set to 15 (13 in MECAT).
  • The default parameters in mecat2cns are relexed so that MECAT2 also works well for low coverage datasets.
  • A new assembly module fsa, which is based on string graph, is used for replacing the original assembly tool mecat2canu.

MECAT2 consists of four modules:

  • mecat2pw, a fast and accurate pairwise mapping tool for SMRT reads

  • mecat2ref, a fast and accurate reference mapping tool for SMRT reads

  • mecat2cns, correct noisy reads based on their pairwise overlaps

  • fsa, a string graph based assembly tool.

MECAT2 is written in C, C++, and perl. It is open source and distributed under the GPLv3 license.

Please note that MECAT2 no longer supports Nanopore raw reads. We have developed a Mapping, Error Correction and de novo Assembly Pipeline specifically for Nanopore Raw Reads NECAT. follow this link to NECAT.

Installation

We have tested MECAT2 on CentOS release 7.3 and on Ubuntu 18.04.

  • Step 1: Figure out where to install MECAT2. We will install MECAT2 and two other auxiliary tools HDF5 and dextract. We first identify the directory in which we want to install them. As an example, I will install them in the directory /home/chenying/smrt_asm. So I first create this directory using the mkdir command and go to that directory: (The dollar sign $ that preceeds the input is the promt that printed by the shell.)
$ mkdir -p /home/chenying/smrt_asm
$ cd /home/chenying/smrt_asm
$ pwd
/home/chenying/smrt_asm

For easy reference, we asign /home/chenying/smrt_asm to an environment variable MECAT_PATH:

$ export MECAT_PATH=/home/chenying/smrt_asm
$ echo ${MECAT_PATH}
/home/chenying/smrt_asm
  • Step 2: Install MECAT2:

There are two ways to install MECAT2. One is to download executable binaries directly:

$ wget https://github.com/xiaochuanle/MECAT2/releases/download/20192026/mecat2_20190226_linuax_amd64.tar.gz
$ tar xzvf mecat2_20190226_linuax_amd64.tar.gz

Another way is to build from source codes:

$ git clone https://github.com/xiaochuanle/MECAT2.git
$ cd MECAT2
$ make 
$ cd ..

After installation, all the executables are found in ${MECAT_PATH}/MECAT/Linux-amd64/bin. The folder name Linux-amd64 will vary in operating systems.

  • Step 3: Add relative pathes
$ export PATH=${MECAT_PATH}/MECAT/Linux-amd64/bin:$PATH

Quick Start

Before running MECAT2, don't forget to add binary paths to PATH (Step 3 of Installation).

Here we take assemblying the genome of Ecoli as an example, to go through each step in order. Details of each step are given in the next section.

  • Step 1: Download dataset.

We download the raw reads ecoli_filtered.fastq.gz into directory ${MECAT_PATH}/ecoli and decompress it:

$ mkdir -p ${MECAT_PATH}/ecoli
$ cd ${MECAT_PATH}/ecoli
$ wget http://gembox.cbcb.umd.edu/mhap/raw/ecoli_filtered.fastq.gz
$ gunzip ecoli_filtered.fastq.gz

After decompression, we get raw read file ${MECAT_PATH}/ecoli/ecoli_filtered.fastq:

$ ls
ecoli_filtered.fastq
  • Step 2: Prepare config file

We create a config file template using the following command:

$ mecat.pl config ecoli_config_file.txt

The above command creates a config file ecoli_config_file.txt, which looks like

PROJECT=
RAWREADS=
GENOME_SIZE=
THREADS=4
MIN_READ_LENGTH=500
CNS_OVLP_OPTIONS=""
CNS_OPTIONS="-r 0.6 -a 1000 -c 4 -l 2000"
TRIM_OVLP_OPTIONS="-B"
ASM_OVLP_OPTIONS="-n 100 -z 10 -b 2000 -e 0.5 -j 1 -u 0 -a 400"
FSA_OL_FILTER_OPTIONS="--max_overhang=-1 --min_identity=-1"
FSA_ASSEMBLE_OPTIONS=""
USE_GRID=false
CLEANUP=0
CNS_OUTPUT_COVERAGE=30
GRID_NODE=0

After filling the relative information, we have

PROJECT=ecoli
RAWREADS=/home/chenying/smrt_asm/ecoli/ecoli_filtered.fastq
GENOME_SIZE=4800000
THREADS=4
MIN_READ_LENGTH=2000
CNS_OVLP_OPTIONS=""
CNS_OPTIONS="-r 0.6 -a 1000 -c 4 -l 2000"
TRIM_OVLP_OPTIONS="-B"
ASM_OVLP_OPTIONS="-n 100 -z 10 -b 2000 -e 0.5 -j 1 -u 0 -a 400"
FSA_OL_FILTER_OPTIONS="--max_overhang=-1 --min_identity=-1"
FSA_ASSEMBLE_OPTIONS=""
USE_GRID=false
CLEANUP=0
CNS_OUTPUT_COVERAGE=30
GRID_NODE=0
  • Step 3: Correct Raw Reads.

Correct the raw noisy reads using the following command:

$ mecat.pl correct ecoli_config_file.txt
  • Step 4: Assemble Contigs Using the Corrected Reads
$ mecat.pl assemble ecoli_config_file.txt
  • Step 5: Where to Find Results

    • The corrected reads is ${MECAT_PATH}/ecoli/ecoli/1-consensus/cns_reads.fasta.
    • The extracted longest 30x corrected reads used for trimming is ${MECAT_PATH}/ecoli/ecoli/1-consensus/cns_final.fasta.
    • The trimmed reads is ${MECAT_PATH}/ecoli/ecoli/2-trim_bases/trimReads.fasta
    • The assembled contigs is ${MECAT_PATH}/ecoli/ecoli/4-fsa/contigs.fasta

Input Format

MECAT2 is capable of processing FASTA, FASTQ, and H5 format files. However, the H5 files must first be transfered to FASTA format by running ${MECAT_PATH}/DEXTRACT/dextract before running MECAT2. For example:

$ find pathto/raw_reads -name "*.bax.h5" -exec readlink -f {} \; > reads.fofn
$ while read line; do   dextract -v $line >> reads.fasta ; done <  reads.fofn

Program Descriptions

We describe in detail each module of MECAT, including their options and output formats.

Config File

MECAT2 reads all the information, including project name, raw reads, and various running parameters, from config file. To create a config file template, just run

$ mecat.pl config config_file_name

The above command creates a config file named config_file_name. We have met an sample of config file in the previous section

PROJECT=ecoli
RAWREADS=/home/chenying/smrt_asm/ecoli/ecoli_filtered.fastq
GENOME_SIZE=4800000
THREADS=4
MIN_READ_LENGTH=2000
CNS_OVLP_OPTIONS=""
CNS_OPTIONS="-r 0.6 -a 1000 -c 4 -l 2000"
TRIM_OVLP_OPTIONS="-B"
ASM_OVLP_OPTIONS="-n 100 -z 10 -b 2000 -e 0.5 -j 1 -u 0 -a 400"
FSA_OL_FILTER_OPTIONS="--max_overhang=-1 --min_identity=-1"
FSA_ASSEMBLE_OPTIONS=""
USE_GRID=false
CLEANUP=0
CNS_OUTPUT_COVERAGE=30
GRID_NODE=0

The meaning of each option is given below

  • PROJECT=ecoli, the name of the project. In this example, a directory ecoli will be created in the current directory, and then everything will take place in the directory ecoli.
  • RAWREADS=, the raw reads (with full path) to be processed by MECAT2. Raw reads must be either FASTA or FASTQ format. The H5 format file must be transferred to FASTA format first (see Input Format).
  • GENOME_SIZE=, the size (in bp) of the underlying genome.
  • THREADS=, number of CPU threads used by MECAT2.
  • MIN_READ_LENGTH=, minimal length of corrected reads and trimmed reads.
  • CNS_OVLP_OPTIONS="", options for detecting overlap candidates in the correction stage.
  • CNS_OPTIONS="", options for correcting raw reads.
  • TRIM_OVLP_OPTIONS="", options for detecting overlaps in the trimming stage.
  • ASM_OVLP_OPTIONS="", options for detecting overlaps in the assemble stage.
  • FSA_OL_FILTER_OPTIONS="", options for filtering overlaps.
  • FSA_ASSEMBLE_OPTIONS="", options for assembling trimmed reads.
  • USE_GRID=false, using multiple computing nodes (true) or not (false).
  • CLEANUP=0, delete intermediate date genrated by MECAT2 (1) or not (0). Please note the in assemblying large genomes, the intermediate data can be very large.
  • CNS_OUTPUT_COVERAGE=30, number of coverage of the longest corrected reads are extracted to be trimed and then assembled. In this example, 30x (specifically, 30 * 4800000 = 144 MB) of the longest corrected reads will be extracted.
  • GRID_NODE=0, number of computing nodes used. This options is used only when USE_GRID=1.

The MECAT2 Workflow.

For easy use, we have integrated all the procedures into one perl script file mecat.pl, which works in the following steps:

meat.pl config, as mentioned above, this command creates a config file. mecat.pl correct, correct raw reads, which consits of two steps:

detecting overlap candidates using mecat2pw. correct raw reads based on overlap candidates using mecat2cns.

mecat.pl assemble, assemble corrected reads in three steps:

extract 30x longest corrected reads trim out low quality subsequences using v2trim.sh in two stpes:

detecting overlaps of extracted reads using v2asmpm.sh trim out low quality subsequence based on their overlaps using v2lcr and v2sr.

assemble trimmed reads into contigs in three steps:

detecting overlaps of trimmed reads using v2asmpm.sh filter out low quality overlaps using fsa_ol_filter assemble trimmed reads into contigs based on high quality overlaps using fsa_assemble

Pairwise Mapping Tool mecat2pw

options

The command for running mecat2pw is

mecat2pw -j [task] -d [fasta/fastq] -w [working folder] -t [# of threads] -o [output] -n [# of candidates] -a [overlap size] -k [# of kmers] -g [0/1]

The options are:

  • -j [task], job name, 0 = detect overlapping candidates only, 1 = output overlaps in M4 format, default = 1. If we are to correct noisy reads, outputing overlapping candidates is enough.

  • -d [fasta/fastq], reads file name in FASTA or FASTQ format.

  • -w [working folder], a directory for storing temporary results, will be created if not exists.

  • -t [# of threads], number of CPU threads used for overlapping, default=1.

  • -o [output], output file name

  • -n [# of candidates], number of candidates considered for gapped extension, default=100. Since each chunk is about 2GB size, number of candidates(NC) should be set by genome size (GS).For GS < 20M, NC should be set as 200; For GS>20M and GS<200M; NC should be set as 100; For GS>200M, NC should be set as 50.

  • -a [overlap size], only output overlaps with length >= a. Default: 2000.

  • -k [# of kmers], two blocks between two reads having >= k kmer matches will be considered as a matched block pair. Default: 4.

  • -g [0/1], output the gapped extension start point (1) or not (0), default=0.

output format

If the job is detecting overlapping candidates, the results are output in can format, each result of which occupies one line and 9 fields:

[A ID] [B ID] [A strand] [B strand] [A gapped start] [B gapped start] [voting score] [A length] [B length]

mecat2pw outputs overlapping results in M4 format, of which one result is given in one line. The fileds of M4 format is given in order below:

[A ID] [B ID] [% identity] [voting score] [A strand] [A start] [A end] [A length] [B strand] [B start] [B end] [B length]

If the -g option is set to 1, two more fields indicating the extension starting points are given:

[A ID] [B ID] [% identity] [voting score] [A strand] [A start] [A end] [A length] [B strand] [B start] [B end] [B length] [A ext start] [B ext start]

In the strand field, 0 stands for the forward strand and 1 stands for the reverse strand. All the positions are zero-based and are based on the forward strand, whatever which strand the sequence is mapped. Here are some examples:

44 500 83.6617 30 0 349 8616 24525 0 1 10081 21813

353 500 83.2585 28 0 10273 18410 22390 1 0 10025 21813

271 500 80.4192 13 0 14308 19585 22770 1 4547 10281 21813

327 501 89.8652 117 0 10002 22529 22529 1 9403 21810 21811

328 501 90.8777 93 0 0 10945 22521 1 0 10902 21811

In the examples above, read 500 overlaps with reads 44, 353, 271, 327 and 328.

memory consumption

Before overlapping is conducted, the reads will be split into several chunks. Each chunk is about 2GB in size so that the overlapping can be run on a 8GB RAM computer.

Reference Mapping Tool mecat2ref

options

mecat2ref is used for mapping SMRT reads to the reference genomes. The command is

mecat2ref -d [reads] -r [reference] -w [folder] -t [# of threads] -o [output] -b [# of results] -m [output format]

The meanings of each option are as follows:

  • -d [reads], reads file name in FASTA/FASTQ format

  • -r [reference], reference genome file name in FASTA format

  • -w [folder], a directory for storing temporary results

  • -t [# of threads], number of working CPU threads

  • -o [output], output file name

  • -b [# of result], output the best b alignments

  • -m [output format], output format: 0 = ref, 1 = M4, 2 = SAM, default = 0

output format

mecat2ref outputs results in one of the three formats: the ref format, the M4 format, and the SAM format.

For the ref format, each result occupies three lines in the form:

[read name] [ref name] [ref strand] [voting score] [read start] [read end] [read length] [ref start] [ref end]

mapped read subsequence

mapped reference subsequence

The strands of the reads are always forward. In the [ref strand] field, F indicates forward strand while R indicates reverse strand. All the positions are zero-based and relative to the forward strand. Here is an example:

1	gi|556503834|ref|NC_000913.3|	F	10	2	58	1988134	1988197

AAT-AGCGCCTGCCAGGCG-TCTTTT--CCGGCCATTGT-CGCAG--CACTGTAACGCGTAAAA

AATTAGCGCCTGCCAGGCGGTCTTTTTTCCGGCCATTGTTCGCAGGG-ACTGTAACGCGTAAAA

In this example, read 1 is mapped to the reference gi|556503834|ref|NC_000913.3|.

memory consumption

  • Index for the genome: genomeSize * 8 bytes

  • Compressed index for each CPU thread: genomeSize * 0.1 * t bytes

  • Local alignment: 100M * t + 1G bytes

Correction Tool mecat2cns

mecat2cns is an adaptive error correction tool for high-noise single-molecula sequencing reads. It is as accurate as pbdagcon and as fast as FalconSense. Inputs to mecat2cns can be either can format or M4 format. The command for running mecat2cns is

mecat2cns [options] overlaps-file reads output

The options are

  • -i [input type], input format, 0 = can, 1 = M4

  • -t [# of threads], number of CPU threads for consensus

  • -p [batch size], batch size the reads will be partitioned

  • -r [ratio], minimum mapping ratio

  • -a [overlap size], overlaps with length >= a will be used.

  • -c [coverage], minimum coverage, default=6

  • -l [length], minimum length of the corrected sequence

The default values for the other options are:

-i 1 -t 1 -p 100000 -r 0.6 -a 1000 -c 4 -l 2000

If the inputs are M4 format, the overlap results in [overlaps-file] must contain the gapped extension start point, which means the option -g in mecat2pw must be set to 1, otherwise mecat2cns will fail to run. Also note that the memory requirement of mecat2cns is about 1/4 of the total size of the reads. For example, if the reads are of total size 1GB, then mecat2cns will occupy about 250MB memory.

output format

The corrected sequences are given in FASTA format. The header of each corrected sequence consists of three components seperated by underlines:

>A_B_C_D

where

  • A is the original read id

  • B is the left-most effective position

  • C is the right-most effective position

  • D is the length of the corrected sequence

by effective position we mean the position in the original sequence that is covered by at least c (the argument to the option -c) reads.

mecat2elr

mecat2elr is used by mecat.pl for extracting 30X longest sequences from the corrected data. The command is

mecat2elr [the input fasta file from mecat2cns] [genome size]  [coverage] [the output filename]

Overlap Filter fsa_ol_filter

fsa_ol_filter is used for filtering out low-quality overlaps. The usage of fsa_ol_filter1 is

fsa_ol_filter [optioins] overlaps filtered_overlaps

The options are

  • --min_length=INT, minimum length of reads (default: 2500)
  • --max_length=INT, maximum length of reads (defualt: INT_MAX).
  • --min_identity=DOUBLE, minimum identity of overlaps (defualt: 90).
  • --min_aligned_length=INT, minimum aligned length of overlaps (default: 2500).
  • --max_overhang=INT, maximum overhang of overlaps (default: 10), negative number = determined by the program.
  • --min_coverage=INT, minimum base coverage (default: -1), negative number = determined by the program.
  • --max_coverage=INT, maximum base coverage (default: -1), negative number = determined by the program.
  • --max_diff_coverage=INT, maximum difference of base coverage (default: -1), negative number = determined by the program.
  • --coverage_discard=DOUBLE, discard ratio of base coverage (default: 0.01). If --max_coverage or --max_diff_coverage is negative, it will be reset to (100-coverage_discard)th percentile.
  • --overlap_file_type="|m4|paf|ovl", overlap file format (default: ""). "" = filename extension, "m4" = M4 format, "paf" = PAF format generated by minimap2, "ovl" = OVL format generated by FALCON.
  • --bestn=INT, output best n overlaps on 5' or 3' end for each read (default: 10).
  • --genome_size=INT, genome size. It determines the maximum length of reads with --coverage together.
  • --coverage=INT, coverage. It determines the maximum length of reads with --genome_size together.
  • --output_directory=STRING, directory for output files (default: ".").
  • --thread_size=INT, number of threads (default: 4).

Assemble Tool fsa_assemble

fsa_assemble is a tool for constructing contigs from filtered overlaps and corrected reads. The algorithm is similar to FALCON. The usage of fsa_assemble is

fsa_assenble [optioins] filtered_overlaps

The options are

  • --min_length=INT, minimum length of reads (default: 0).
  • --min_identity=DOUBLE, minimum identity of overlaps (defualt: 0).
  • --min_aligned_length=INT, minimum aligned length of overlaps (default: 0).
  • --min_contig_length=INT, minimum length of contigs (default: 500).
  • --read_file=STRING, reads file name in FASTA or FASTQ format.
  • --overlap_file_type="|m4|paf|ovl", overlap file format (default: ""). "" = filename extension, "m4" = M4 format, "paf" = PAF format generated by minimap2, "ovl" = OVL format generated by FALCON.
  • --output_directory=STRING, directory for output files (default: ".").
  • --select_branch="no|best", selecting method when encountering branches in the graph, "no" = do not select any branch, "best" = select the most probable branch.
  • --thread_size=INT, number of threads (default: 4)

Citation

Chuan-Le Xiao, Ying Chen, Shang-Qian Xie, Kai-Ning Chen, Yan Wang, Yue Han, Feng Luo, Zhi Xie. MECAT: fast mapping, error correction, and de novo assembly for single-molecule sequencing reads. Nature Methods, 2017, 14: 1072-1074

Contact

Update Information

Updates in MECAT2 (20193.14):

  • Add some improvements in FSA

  • Optimize Install Method

Updates in MECAT2 (2019.2):

  • Fix many bugs in MECAT

  • Replace the asseble module mecat2canu by fasa.

Updates in MECAT V1.3 (2017.12.18):

  • Correct text error in HDF5 Installation.

  • Update the makefile in dextract .

  • Update citation.

Updates in MECAT V1.2 (2017.5.22):

  • Add trimming module in mecat2canu to improve the integrality of the assembly.

  • Add supports for Nanopore data.

  • Improve the sensitivity of mecat2ref.

MECAT v1.1 replaced the old MECAT,some debug were resolved and some new fuctions were added:

    1. we added the extracted tools for the raw H5 format files.
    1. some debugs from running mecat2canu were solved

About

No description, website, or topics provided.

Resources

Stars

Watchers

Forks

Packages

No packages published

Languages

  • C++ 86.3%
  • C 12.1%
  • Other 1.6%