Scientific notation in full probe file output

[foriin]

Hi,
Could you please update the PaintSHOP to turn off the scientific notation when printing the target region in the file with the probes? It makes parsing the file a bit more challenging :)
E.g. running for dm6 genome and chrX 2000000-2100000 will produce this:

chrom	start	stop	sequence	Tm	on_target	off_target	repeat_seq	prob	max_kmer	probe_strand	target
chrX	2000028	2000057	CACACCCTCCTCGGTGGCGCCGCAGAATAA	46.83	99.113	0	0	0.145	0	+	chrX_2e+06-2100000
chrX	2000067	2000096	CGCCCAACTCCTGCTCTCCCTGGGACAGAC	46.38	100	0	0	0.146	0	+	chrX_2e+06-2100000
...

Thanks,
Artem