Software implementation of CParty.
CParty is an algorithm for computing the conditional partition function for density-2 RNA pseudoknots.
Trinity, Luke, Sebastian Will, Yann Ponty, Ulrike Stege, and Hosna Jabbari. "CParty: Conditional partition function for density-2 RNA pseudoknots." bioRxiv (2023): 2023-05. https://doi.org/10.1101/2023.05.16.541023
Linux macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.7.2 or higher) and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:
/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"
When that finishes, run the following from a terminal to install CMake.
brew install cmake
Run from a terminal
wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++17 features.
Usage: CParty[options] [input sequence]
Read input file from cmdline; predict minimum free energy, ensemble energy, optimum structure, and BPP structure using the RNA folding algorithm.
-h, --help Print help and exit
-V, --version Print version and exit
-r, --input-structure Give a restricted structure as an input structure
-i, --input-file Give a path to an input file containing the sequence (and input structure if known)
-o, --output-file Give a path to an output file which will the sequence, and its structure and energy
-n, --opt Specify the number of suboptimal structures to output (default is 1)
-p --pk-free Specify whether you only want the pseudoknot-free structure to be calculated
-k --pk-only Only add base pairs which cross the constraint structure. The constraint structure is returned if there are no energetically favorable crossing base pairs
-d --dangles Specify the dangle model to be used (base is 2)
-P, --paramFile Read energy parameters from paramfile, instead of using the default parameter set.\n
-s, --samples Give the number of samples foe the stochastic backtracking (default 1000)
--noConv Do not convert DNA into RNA. This will use the Matthews 2004 parameters for DNA
--noPS Don't create a Postscript drawing of the base pair probabilities
Remarks:
make sure the <arguments> are enclosed in "", for example -r "..(...).." instead of -r ..(...)..
input file for -i must be .txt
if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
if -o is provided with just a file name without a path, and if -i is provided, then the output file will be generated in the directory where the input file is located
if suboptimal structures are specified, repeated structures are skipped. That is, if different input structures come to the same conclusion, only those that are different are shown
If no input structure is given, or suboptimal structures are greater than the number given, CParty generates hotspots to be used as input structures -- where hotspots are energetically favorable stems
The default parameter file is DP09. This can be changed via -P and specifying the parameter file you would like
A Postscript file will be generated automatically showing the base pairing probabilities. This can be turned off with --noPS
Sequence requirements:
containing only characters GCAU
Structure requirements:
-pseudoknot free
-containing only characters .x()
Remarks:
Restricted structure symbols:
() restricted base pair
. no restriction
x restricted to unpaired
Input file requirements:
Line1: FASTA name (optional)
Line2: Sequence
Line3: Structure
sample:
>Sequence1 (optional)
GCAACGAUGACAUACAUCGCUAGUCGACGC
(............................)
Output text format:
Line1: Sequence
Line2: MFE structure (MFE energy)
Line3: BPP structure (Ensemble Energy)
Remarks:
The BPP structure gives an output structure based on the probabilitiy of that base pair
occuring across the sampled structures. For pseudoknot-free base pairs,
{} indicates .334<p<=.667 and () indicate p>.667.
For pseudoknotted base pairs /\ indicates .334<p<=.667 and [] indicate p>.667.
Dot plot Postscript files give the output in graphical form. Input constraints
are in black and other probabilities are in red. The MFE structure is in the
bottom left while the probability structure is in the top right.
Assume you are in the CParty directory
./build/CParty -i "/home/username/Desktop/myinputfile.txt"
./build/CParty -i "/home/username/Desktop/myinputfile.txt" --o "outputfile.txt"
./build/CParty -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -r "(((((.........................)))))................" -d2 GGGGGAAAAAAAGGGGGGGGGGAAAAAAAACCCCCAAAAAACCCCCCCCCC
./build/CParty -p -r "(............................)" -o "/home/username/Desktop/some_folder/outputfile.txt" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -n 3 -r "(............................)" -o "/home/username/Desktop/some_folder/outputfile.txt" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -k -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -P "params/rna_Turner04.par" -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -s 10000 --noPS -r "(............................)" GCAACGAUGACAUACAUCGCUAGUCGACGC
./build/CParty -r "..(((((((((((..........)))))))))))....................................." UUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCU
For questions, you can email mateo2@ualberta.ca