This directory will generate test data test_R1.fastq.gz and
test_R2.fastq.gz files from a full TRIP experiment on mouse. These test files
will contain only reads from chromosome 19 identified in the normalization,
expression, and mapping libraries. The small size of the test data allows for
downstream analyses to run quickly and are designed for CI/CD testing of the TRIP
analysis software, trip-wire.
The workflow in this repo extracts chr19 barcodes from the normalization, expression, and mapping library from the either the original TRIP Perl script or the TRIP-wire pipeline. The test dataset is built from 2 pools/experiments for 2 conditions with 2 technical replicates each. See below for configuration details.
The data resulting data are included in this repo. The code in the repository and the instructions below are for re-generating test data -- perhaps from a different kind of experiment or different organism, or using different parameters.
Here is a DAG (directed acyclic graph) of the workflow:
The example fastq files in this repo are a good size for testing the Snakemake workflow, but they result in too few barcode with nonzero counts such that the downstream DESeq2 analysis can't estimate variance.
So in the downstream directory we provide a separate set of results with subsetted samples and randomized names from running the workflow on actual data that can be used for testing the RMarkdown differential analysis in trip-wire.
-
Clone this directory using
git clone https://github.com/NICHD-BSPC/trip-wire-test-data -
With conda installed and the Bioconda channel set up, build and create a conda environment using
mamba create -p ./env --file requirements.txt -
Activate the environment using
conda activate ./env -
Set up your input data. Data must go in
full_datasetandfastqas follows:
full_dataset/
This must include two subdirectories, trip_output and demux_data.
full_dataset/trip_output/ has one directory for each pool/techrep/condition combination,
and inside that directory is a single file, final_TRIP_data_table.txt. The
contents of those files look like this:
barcode norm exp_1 chr_f ori_f pos_f reads_f mapq_f freq1_f freq2_f chr_r ori_r pos_r reads_r mapq_r freq1_r freq2_r
GATTTAGTCGCTCTCG 22249 37891 * 4 0 8942 0.00 0.208 0.156 chr5 - 48504758 8830 39.02 0.394 0.247
TTGGTGGTGTAAGGGA 18845 10945 chr8 + 60954656 29617 34.61 0.193 0.161 chr8 - 60954872 29446 43.92 0.314 0.180
AATACAAATCGTGGAA 16780 6067 * 4 0 7486 0.00 0.208 0.179 * 4 0 7393 2.50 0.286 0.147
full_dataset/demux_data/ must have one fastq file for each of the pool/techrep/condition
combinations above, but also R1 and R2 for each, and also each library type
(mapping, normalization, and expression).
The following filename formats are expected:
- Mapping:
demux_data/pool{pool}_{condition}_{library}_{read}.fastq.gz - Expression:
demux_data/pool{pool}_techrep{techrep}_{condition}_{library}_{read}.fastq.gz - Normalization:
demux_data/pool{pool}_techrep{techrep}_{condition}_{library}_{read}.fastq.gz
fastq/
This directory must contain two files, Undetermined_R1.fastq.gz and
Undetermined_R2.fastq.gz. These are the full, still-multiplexed fastq files
from which the data in full_dataset/demux_data was generated.
For example, here is what the directory would look like with the files from this repository, plus the conda environment, and all input data for an experiment with R1 and R2, conditions "treatment" and "control", two pools "a" and "b", and two technical replicates for each, "1" and "2":
.
├── env
├── requirements.txt
├── Snakefile
├── full_dataset
│ ├── trip_output
│ │ ├── poola_techrep1_treatment
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poola_techrep1_treatment
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poola_techrep1_control
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poola_techrep2_treatment
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poola_techrep2_control
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poolb_techrep1_treatment
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poolb_techrep1_control
│ │ │ └── final_TRIP_data_table.txt
│ │ ├── poolb_techrep2_treatment
│ │ │ └── final_TRIP_data_table.txt
│ │ └── poolb_techrep2_control
│ │ └── final_TRIP_data_table.txt
│ └── demux_data
│ ├── poola_treatment_mapping_R1.fastq.gz
│ ├── poola_control_mapping_R1.fastq.gz
│ ├── poola_techrep1_treatment_expression_R1.fastq.gz
│ ├── poola_techrep1_treatment_normalization_R1.fastq.gz
│ ├── poola_techrep1_control_expression_R1.fastq.gz
│ ├── poola_techrep1_control_normalization_R1.fastq.gz
│ ├── poola_techrep2_treatment_expression_R1.fastq.gz
│ ├── poola_techrep2_treatment_normalization_R1.fastq.gz
│ ├── poola_techrep2_control_expression_R1.fastq.gz
│ ├── poolb_techrep2_control_normalization_R1.fastq.gz
│ ├── poolb_treatment_mapping_R1.fastq.gz
│ ├── poolb_control_mapping_R1.fastq.gz
│ ├── poolb_techrep1_treatment_expression_R1.fastq.gz
│ ├── poolb_techrep1_treatment_normalization_R1.fastq.gz
│ ├── poolb_techrep1_control_expression_R1.fastq.gz
│ ├── poolb_techrep1_control_normalization_R1.fastq.gz
│ ├── poolb_techrep2_treatment_expression_R1.fastq.gz
│ ├── poolb_techrep2_treatment_normalization_R1.fastq.gz
│ ├── poolb_techrep2_control_expression_R1.fastq.gz
│ └── poolb_techrep2_control_normalization_R1.fastq.gz
└── fastq
├── Undetermined_R1.fastq.gz
└── Undetermined_R2.fatq.gz
- Optionally edit the following parameters in the
Snakefile, and ensure that the filenames in the input directory have the right corresponding pattern.
| Parameter Name | Example | Description |
|---|---|---|
pool |
['a', 'b', 'c', 'd'] |
Names of the pools/experiments. Designate as many pools/experiments you want to analyze. |
techrep |
['1', '2'] |
Number of technical replicates provided. Designate as many technical replicates you have. |
condition |
['treatmentA', 'treatmentB', 'control'] |
Condition naming convention. Designate as many conditions you have. |
- Run the Snakefile using
snakemake -j <N>where<N>is the number of cores to provide.
The expected output will be found in results/test_R1.fastq.gz and results/test_R2.fastq.gz.
The results of running this workflow on (currently-unpublished) data can be found in this repo at these paths.
The rules within the Snakefile will do the following:
1) getBarcodes: Extracts all the barcodes from each of the trip output's full, demultiplexed 'final table', and pulls only lines (barcodes) that have Chr19.
processing/barcodes_poola.txt:
AAAATCTAGGAGCCCA
AAAATCTGCCTCTTAC
AAAATTCATAGCAGCA
2) makeFasta: Changes the file type from a list of barcodes to a fasta format.
processing/barcodes_poola.fasta:
>0
AAAATCTAGGAGCCCA
>1
AAAATCTGCCTCTTAC
>2
AAAATTCATAGCAGCA
Note that different pools can share a small number of barcodes. If we were to look for a chr19 barcode from pool A directly in the full (still-multiplexed) dataset, we might find pool B reads with that barcode -- but they will not necessarily be mapped to chr19, and thus our dataset would no longer be restricted to chr19 and as a result it would grow larger.
So we look for barcodes in a pool-specific manner, using the demultiplexed fastq files.
3) cutadaptGetIDMapp: Extract the readIDs matching chr19 barcode using Cutadapt for the mapping library.
Example of output files:
r1cutadapt_mapping_poola_treatment.fastq:
@A01256:215:HGKNKDRX2:1:2101:9019:1517 1:N:0:0
ACTGTACAGTGTCACAAGGGCCGGCCACAACTCGAGTGACTAGTAAAGTAACTGATCTATGCCTCGCTTCACTGACTACTTACCATAGGCACCAAGAGGCA
+
FFF,FFFF:F:FFF,,F,:FF,FFFFF:,FFF:FFFFFFFFF:,:FFFFF:FF,FFF:::,,FF:F,FF,F:FF:::FFF,,:FFFFF,,:F,:FFF,,FF
@A01256:215:HGKNKDRX2:1:2101:3640:3067 1:N:0:0
ACTGTACAGTGTCACAAGGGCCGGCCACAACTCGAGTAACCTGTTGTGCGACTGATCACAAGCAACACAAACACAGACCTATAGACACACAGAACACAGAC
+
FF:,FFFFFFFF:F:FFF,FF:FFF:,,,,F:,FFF:F:FFF,:,:FFFF:F:F,F,:FF:FFFFFF:F,:,,F,,FF,:F::F:FF:F:F:F,F:F,::,
readID_mapping_poola_treatment.txt:
A01256:215:HGKNKDRX2:1:2101:9019:1517
A01256:215:HGKNKDRX2:1:2101:3640:3067
Note: the _1:N:0:0 is chopped off because seqtk cannot handle whitespaces.
4) ExtractReadsWithIDMapp: Using the read IDs from above, extract the full read from the full still-multiplexed dataset for the mapping library.
mappingRead_poola_treatment_R1.fastq:
@A01256:215:HGKNKDRX2:1:2101:9019:1517 1:N:0:0
ACTGTACAGTGTCACAAGGGCCGGCCACAACTCGAGTGACTAGTAAAGTAACTGATCTATGCCTCGCTTCACTGACTACTTACCATAGGCACCAAGAGGCA
+
FFF,FFFF:F:FFF,,F,:FF,FFFFF:,FFF:FFFFFFFFF:,:FFFFF:FF,FFF:::,,FF:F,FF,F:FF:::FFF,,:FFFFF,,:F,:FFF,,FF
@A01256:215:HGKNKDRX2:1:2101:3640:3067 1:N:0:0
ACTGTACAGTGTCACAAGGGCCGGCCACAACTCGAGTAACCTGTTGTGCGACTGATCACAAGCAACACAAACACAGACCTATAGACACACAGAACACAGAC
+
FF:,FFFFFFFF:F:FFF,FF:FFF:,,,,F:,FFF:F:FFF,:,:FFFF:F:F,F,:FF:FFFFFF:F,:,,F,,FF,:F::F:FF:F:F:F,F:F,::,
5) cutadaptGetIDNormExpr: Extract the readIDs matching chr19 barcode using Cutadapt for the norm and expression libraries.
Output files would look like this:
r1cutadapt_techrep1_normalization_poola_treatment.fastq:
@A01256:215:HGKNKDRX2:1:2101:6244:5228 1:N:0:0
CGTAGACTAGGTCACAAGGGCCGGCCACACCTCGAGGTAAGCGGCGCCCAAATGATCCTTCAGTGTCAACTAAATCTTAGGCGGCCGCGAATTCTGCCTTT
+
FF:,FFFF,FFFFF,FFFFFFFFFF:FFFF,FF,F,F:FFF,FFF:,FFF:F,FF,F,FF,FF,:FF,FF:,FF:F:,,FFFF,FFF,,,,,FFFF:F:FF
@A01256:215:HGKNKDRX2:1:2101:5376:7482 1:N:0:0
CGTAGACTAGGTCACAAGGGCCGGCCACAACTCGAGCCAATACATATTCTTCTGATCCTGACGTGTCACATAACTCTTCTTCGGACGCGAATTCTTACTTG
+
FF,:F,FF,F:F:::,::::F,F:FFFFF,::,,F,FFFF,,,:,F::F:::F:FF,F:,,F::,,,::,F,,:F,,,:F,,,,:,,,FF,::,,,:FF:,
readID_techrep1_normalization_poola_treatment.txt:
A01256:215:HGKNKDRX2:1:2101:6244:5228
A01256:215:HGKNKDRX2:1:2101:5376:7482
6) extractReadsWithIDNormExpr: Using the read IDs from above, extract the full read from the full still-multiplexed dataset for the norm and expression libraries.
Output files would look like this:
normalizationRead_techrep1_poola_treatment_R1.fastq:
@A01256:215:HGKNKDRX2:1:2101:6244:5228 1:N:0:0
CGTAGACTAGGTCACAAGGGCCGGCCACACCTCGAGGTAAGCGGCGCCCAAATGATCCTTCAGTGTCAACTAAATCTTAGGCGGCCGCGAATTCTGCCTTT
+
FF:,FFFF,FFFFF,FFFFFFFFFF:FFFF,FF,F,F:FFF,FFF:,FFF:F,FF,F,FF,FF,:FF,FF:,FF:F:,,FFFF,FFF,,,,,FFFF:F:FF
@A01256:215:HGKNKDRX2:1:2101:5376:7482 1:N:0:0
CGTAGACTAGGTCACAAGGGCCGGCCACAACTCGAGCCAATACATATTCTTCTGATCCTGACGTGTCACATAACTCTTCTTCGGACGCGAATTCTTACTTG
+
FF,:F,FF,F:F:::,::::F,F:FFFFF,::,,F,FFFF,,,:,F::F:::F:FF,F:,,F::,,,::,F,,:F,,,:F,,,,:,,,FF,::,,,:FF:,
7) catAllReads: Concatenate all reads between all three libraries together.
Output files will be named:
results/test_R1.fastq
results/test_R2.fastq
8) download_reference_fastas, build_index: Make a minimal bowtie2 index
This index is built using chr19 and chr14 of the UCSC mm10 assembly and stored in the repo so that it can be used by other tools for testing, rather than requiring a full index of the entire mouse genome.
