Added support and testing for MNPs

[kdahlo]

This change allows SpliceAI to provide delta scores for MNPs (Multiple Nucleotide Polymorphisms). Previous SpliceAI behavior was to filter MNPs without performing calculations. This change allows for calculation of delta scores on MNPs without changing the way that delta scores are calculated for other variants. Under this change, the delta score of the ALT allele is calculated by taking the maximum score across the ALT allele, and comparing the maximum score against the first nucleotide of the REF allele. This practice is similar to the existing practice of SpliceAI when the ALT allele contains an insertion.

[bw2]

Until this is merged into the official repo, I've merged it into my fork @ https://github.com/bw2/SpliceAI
so it can be used @ https://spliceailookup.broadinstitute.org/

[Hoeze]

@jeremymcrae do you have merge permissions for this repository and could publish a new release including this PR?

[Hoeze]

This PR fails for the following variant:

chrom='chr5',
pos=90753670,
ref='GACACAGGACCTTTATGGAGCTGCTTCAAAATTAGTCATCAAAGATAAATCACTCTTCAAGGGAGGATTCATTGAGAGTGAG', 
alt='ATTGT'

[Hoeze]

I think this commit fixes the problem, would you mind checking @kdahlo @bw2 ?
Hoeze@c2a0e82

Basically, we re-use the first if-case by inserting only enough zeros to match the size of the reference sequence.