A nextflow pipeline to handle RNA-seq data from FASTQ files to end results, with a special focus on splicing and gene-fusion events.
- Nextflow (tested with version
24.10.4-all) - Singularity (tested with version
CE 3.8.0)
Singularity containers can be downloaded from Sylabs' Singularity Container Services, either manually or automatically by Nextflow using the library://... syntax (see example below). The repository URL is https://cloud.sylabs.io/library/mareschalsy/hcl/sami.sif, using SAMI's version tags as container tags (e.g. sami.sif:1.8.3 for the V1 branch and sami.sif:2.1.0 for the V2 branch).
The container recipe is part of SAMI's source code, it can be built with :
sudo singularity build SAMI.sif SAMI.def- Browse https://www.gencodegenes.org/human/ for latest versions.
- Reference genome, as a single FASTA file :
- Reference transcriptome, as a single GTF file :
- Browse https://www.ncbi.nlm.nih.gov/datasets/taxonomy/9606/ for latest versions.
- Reference genome, as a single FASTA file :
- Reference transcriptome, as a single GTF file :
#!/bin/bash
# Annotation files (to be downloaded manually first)
genome="$(pwd)/store/GCA_000001405.15_GRCh38_full_analysis_set.fna"
GTF="$(pwd)/store/GCA_000001405.15_GRCh38_full_analysis_set.refseq_annotation.gtf"
# Launch pipeline
nextflow run main.nf -with-singularity "library://mareschalsy/hcl/sami.sif:2.1.0" \
--genomeFASTA "$genome" --genomeGTF "$GTF" --title "SeraSeq" --input "data/SeraSeq/example.csv" \
--stranded "R2" --umi --umi_protrude 6 --trimR1 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA' --trimR2 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT' \
--classes "plausible" --min_I 5 --min_PSI 0.1 --fusions true| Argument | Default value | Description |
|---|---|---|
| --input | <none but required> | Sample sheet describing FASTQ files (comma separated, with named columns "sample", "R1" and "R2"). Single-end data can be used, just leaving "R2" empty. |
| --title | <none but required> | Series’ name, to print on MultiQC report and use in file names. |
| --genomeFASTA | <none but required> | Multi-FASTA file containing all chromosomes of the genomic reeference, for alignment (see example above). |
| --genomeGTF | <none but required> | GTF file describing genes, transcripts and exons for the whole transcriptome (see example above). |
| --targetGTF | --genomeGTF | GTF file describing genes, transcripts and exons for the captured genes of interest (can be the whole transcriptome). |
| --species | "Human" | Name of the sample species, for file annotation. |
| --genome | "GRCh38" | Name of the assembly of reference genome used, for file annotation. |
| --chromosomes | "1,2,3,...,21,22,X,Y" | Ordered list of chromosomes to consider during the analysis. |
| --CN | <none> | Sequencing center name (to populate the CN field in @RG of BAM files) |
| --PL | "ILLUMINA" | Sequencing technology used (to populate the PL field in @RG of BAM files, see SAM file specification for allowed values) |
| --PM | <none> | Sequencer model name (to populate the PM field in @RG of BAM files) |
| --fastq_check | true | Whether to check consistency of first read headers and populate @RG "PU" field or not. Use false if your FASTQ files use custom read names. |
| --multimap | 5 | Maximum amount of mapping locations for a read to be considered aligned (-1 for all). |
| --stranded | "no" | Whether a stranded RNA-seq library was used or not ("no", "R1" or "R2"), used for QC and splicing analysis. |
| --store | "./store" | Path to long term storage for processed annotation files, to speed-up consecutive launchs of the pipeline. |
| --output | "./output" | Path to output directory, where files of interest are published. |
| --publish | "copy" | Publishing mode for output files (see Nextflow documentation). |
| --MQC_title | --title | Title for the MultiQC report. |
| --MQC_comment | <none> | Free comment to add at the beginning of the MultiQC report. |
| Argument | Default value | Description |
|---|---|---|
| --trimR1 | <none> | Sequence to trim in 3’ of R1 (cutadapt -a). |
| --trimR2 | <none> | Sequence to trim in 3’ of R2 (cutadapt -A). |
| Argument | Default value | Description |
|---|---|---|
| --umi | false | Whether to deduplicate reads based on pass 1 STAR alignment and UMI content (consensus read) or not. |
| --umi_protrude | 0 | Length of UMIs, only if they were located in 5’ of both R1 and R2 and extracted from the reads prior to launching SAMI (alignment parameters will be adjusted accordingly). Otherwise use 0. |
| Argument | Default value | Description |
|---|---|---|
| --splicing | true | Whether to look for aberrant splicing events or not. |
| --flags | 0 | Similar to samtools view -F during junction counting. |
| --min_PSI | 0.01 | Minimum Percentage Spliced In (PSI) to retain an aberrant junction as a candidate (between 0 and 1). |
| --min_I | 3 | Minimum amount of (deduplicated) reads supporting an aberrant junction to retain it as a candidate. |
| --min_reads_unknown | 10 | "Unknown" junctions without this amount of reads or more in at least one sample will be ignored (significantly reduces computing time). |
| --plot | true | Whether to produce plots of genes and samples with at least one junction passing filters or not. |
| --fusions | true | Whether to call gene-fusions or only splicing events inside genes. |
| --classes | plausible,anchored | Classes of events to retain as candidates (see dedicated section below). |
| --transcripts | <none> | Preferred transcripts to focus on (tab-separated file without header, with gene symbols in first column and transcript ID in second column). Used only to populate extra columns in splicing results, no filtering is performed based on these. |
| --symbols | "target" | Only junctions involving these genes will be retained as candidates (use "all" to disable the filtering, or "target" to refer to genes defined in --targetGTF). |
| Argument | Default value | Description |
|---|---|---|
| --varcall | false | Whether to perform SNV and short indel calling or not. |
| --COSMIC | <none but required> | VCF file of known pathogenic variants (bgzipped and TBI indexed) |
| --gnomAD | <none but required> | VCF file of known polymorphisms (bgzipped and TBI indexed) |
| --window | <none> | Genomic window in which to perform the variant calling (to speed-up tests mainly, leave empty to call in the entire genome). |
The trade-off between sensitivity and specificity is mainly controled by --min_I (amount of split-reads supporting the event, after UMI-based deduplication) and --min_PSI (proportion of all splicing occuring at the site that the event represents). During SAMI's validation, 4 profiles were considered :
- no-filter :
--min_I=1 --min_PSI=0 - sensitive :
--min_I=3 --min_PSI=0.01 - intermediate :
--min_I=5 --min_PSI=0.05 - stringent :
--min_I=10 --min_PSI=0.1
Notice that these arguments control junctions to plot and include in the "Candidates.tsv" file, the full unfiltered list of all detected junctions (corresponding to "no-filter" above) is always available in the "All.tsv" file.
SAMI's default behavior is to allow up to 5 different mapping locations with similar quality for each read (see STAR's --outSAMmultNmax), and count junctions introduced by all 5 of them.
To obtain the highest specificity, one can consider using --multimap 1 to instruct SAMI to discard any read which could map in multiple locations. Using --flags 256 in combination with --multimap higher than 1 can also be used to instruct SAMI to count each read only once, whatever the amount of mapping locations STAR suggested (only the read flagged as "PRIMARY" by STAR will be retained, which can be random when alignment scores are similar).
To obtain the highest sensitivity, one can consider using --multimap -1 to instruct SAMI to keep all alternative mapping locations STAR suggested.
SAMI detects and classifies splicing events as follows :
"annotated" junctions are introns described in at least one transcript of the provided annotation. They correspond to physiological splicing, useful to compute PSI values and assess gene coverage but not as candidate events.
"plausible" junctions are splicing gaps joining the ends of two known exons, but this particular combination of exons is not found in any transcript of the provided annotation. They correspond typically to exon skips, and should be considered as high quality candidates.
These gaps are "anchored" on one splicing site described in the provided annotation, either the left site (left-most genomic position, regardless of transcription strand) or the right site. The second splicing site involved in such an event is unknown to the annotation, and could correspond to a neo-exon or an alternative splicing site.
When setting the --classes argument, "anchored" can be used to refer to both "anchored-left" and "anchored-right".
These events corresponds to potential intron retentions, i.e. the sequencing reads continue in the intron past the splicing site. Their computation differ significantly from other events : they are quantified measuring sequencing depth at +3 or -3 bp of each splicing site described in the annotation.
DNA contamination of a RNA-seq library may lead to over-estimate intron retentions computed with this strategy, consider these events with caution.
When setting the --classes argument, "nosplice" can be used to refer to both "nosplice-left" and "nosplice-right".
Very similar to nosplice events described above, they correspond to reads passing through a de novo splicing site discovered in the analyzed dataset. They are typically used as alternatives to compute PSI values but are not pertinent as aberration candidates, as they usually correspond to reads mapping unspliced on known exons or introns.
When setting the --classes argument, "trivial" can be used to refer to both "trivial-left" and "trivial-right".
Events are considered "unknown" if neither of the two involved splicing sites are described in the annotation. Such events are usually alignment artefacts but might be part of a complex splicing event. Notice they have to pass the extra --min_reads_unknown filter to be reported in the "All.tsv" and "Candidates.tsv" files.
SAMI's splicing analysis produces two tables per parameter set :
All.tsvcontains all splicing events considered during the analysis, without filtering (except--min_reads_unknow).Candidates.tsvis a subset of the former, obtained after applying filters.
These tables contain one row per event, duplicated for all samples in which it was detected.
Generic columns are :
- ID : Unique arbitrary identifier attributed to the row. Letters are attributed from events with highest amounts of supporting reads to lowest, numbers correspond to patient IDs (i.e. events F4 and F5 are the same event in two distinct patients). IDs are only attributed to events passing filters (all rows in
Candidates.tsv), they match with correspondingAll.tsvand plot files but only for the current analysis. - junction : Genomic identifier of the considered junction (genomically left-most and right-most splicing sites).
- class : Event class attributed by SAMI (see previous chapter for details).
- recurrence : Amount of patients of the current analysis in which this specific junction was found (in
Candidates.tsvthe recurrence is computed after filtering, inAll.tsvits is computed without filtering). - sample : Name of the sample considered.
- reads : Amount of split-reads supporting the junction (after UMI deduplication, if it was activated).
- fusion : Whether this junction corresponds to a fusion of distinct genes or an intragenic splicing event.
Follow two sets of columns, corresponding to the left-most splicing site (regardless of transcription strand, this is always the site with lowestgenomic coordinate) and right-most splicing site of the considered junction :
- *.chrom : Chromosome on which the site is located.
- *.pos : Genomic position of the splicing site of the chromosome.
- *.genes : List of genes in which this splicing site is located (exon or intron), with the expected transcription strand.
- *.exons.all : List of exons in which this splicing site is located. Values are collected for all overlaped transcripts, and duplicated values are removed.
X]indicates that the splicing site corresponds to the right boundary of exonX, and similarily[Xcorrespond to the left boundary of the exon. When an exon number is listed without bracket, the splicing site is located inside the exon. - *.transcripts.preferred : Transcripts of interest from the file optionnaly provided with
--transcriptswhich are overlapped by the splicing site. - *.exons.preferred : Similar to
*.exons.all, but considering only transcripts of interest optionnaly provided with--transcripts. - *.depth : Sequencing depth at the splicing site.
- *.PSI : Percentage Splice-In of the considered junction at the considered splicing site (between 0 and 1). This is computed as the proportion of all reads supporting the considered junction divided by the amount of reads supporting any splicing event at the considered splicing event (including the "no-splice" alternative, i.e. no splicing at all).
With --plot, SAMI produces one plot for each sample and each gene harboring at least one event passing filters.
The middle part of the plot describes all transcripts known in the annotation for the considered gene. Exons are numbered in the transcription order, and split into consecutive boxes when exons from multiple transcripts overlap with alternative 5' or 3' splicing sites. Exons are colored according to their relative sequencing depth, from black for the highest sequencing depth to white for the lowest (this is a relative scale which can't be compared between plots).
The upper part of the plot describes annotated junctions : each arch describes one junction, its height depending on the amount of supporting reads. Events passing filters are drawn in solid lines (and the corresponding row ID in tables is displayed), events filtered out in dotted lines. With stranded sequencing kits (--stranded), supporting reads are presented separately for the expected transcription strand (blue) and the opposite one (red).
The lower part describes all other classes of junctions similarily. Fusions are also displayed as vertical lines, with the event ID and the symbol of the fusion partner.


