Skip to content

EESI/seq2att

 
 

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

14 Commits
 
 
 
 
 
 
 
 

Repository files navigation

seq2att: Learning, Visualizing and Exploring 16S rRNA Structure Using an Attention-based Deep Neural Network

seq2att is a command line interface to train a Read2Pheno model on customized 16S rRNA dataset.
Drexel University EESI Lab, 2020
Maintainer: Zhengqiao Zhao, zz374 at drexel dot edu
Owner: Gail Rosen, gailr at ece dot drexel dot edu

Conda installation:

## If you don't have compatible GPUs for training (CPU only) 
conda create -n seq2att python=3.5.4 biopython=1.71 pandas=0.20.3 matplotlib=2.1.1 scipy=1.0.0 scikit-learn=0.19.1 tensorflow=1.9.0 keras=2.2.2
source activate seq2att
# If you want to use GPUs to accelerate your training process
conda create -n seq2att python=3.5.4 biopython=1.71 pandas=0.20.3 matplotlib=2.1.1 scipy=1.0.0 scikit-learn=0.19.1 tensorflow-gpu=1.9.0 keras-gpu=2.2.2
source activate seq2att

git clone https://github.com/z2e2/seq2att.git
cd seq2att
python setup.py install

Steps to use this tool:

1. Prepare your data

A raw data directory is required. It contains a comma separated file (CSV) and FASTA nucleic acid files for different samples. The directory structure of raw data is shown below:

raw_data
│   meta_data.csv  
|   SAMPLE_1.fna
|   SAMPLE_2.fna
|   SAMPLE_3.fna
|   ...

Formats of the required files is shown below:

  1. meta_data.csv format example:
sample_id label
SAMPLE_1 feces
SAMPLE_2 tongue
SAMPLE_3 feces
SAMPLE_4 skin
... ...
  1. SAMPLE_1.fna format example:
>SAMPLE_1_1
GCGAGCGAAGTTCGGAATTACTGGGCGTAAAGGGTGTGTA
>SAMPLE_1_2
GCGAGCGTTGTTCGGAACCACTGGGCGTAAAGGGTGTGTA
>SAMPLE_1_3
GCGAGCGTTGTTCGGAATTACTGGGCGTAGAGGGTGTGTA

2. Edit the configuration file

The user should edit the config.yml file to configure the model specs including the path to your data and the hyperparameters of the model. The following parameters should be edited based on your data. Please also carefully review the config.yml file's comments for more detailed information for the rest of parameters and make sure you also modified them accordingly.

  1. in_dir: the absolute path to the raw data directory (should be created by the user in advance).
  2. out_dir: the absolute path to the processed data directory (should be created by the user in advance and files will be generated by this program).
  3. num_train_samples_per_cls: the number of training sample per class. Note that the rest of samples will be automatically placed in the testing set used for evaluation. If you decide to use all the data for training, then the testing set will be empty and then hence the downstreaming evaluation command won't work.
  4. SEQLEN: sequence length.
  5. BASENUM: the number of unique characters (nucleotides/amino acids) (e.g., for DNA reads, there are 4 major bases for DNA sequence input, therefore you can set BASENUM to 4). 6, Ty: the number of target classes (Ty >= 2).
  6. save_model_path: the absolute path to the saved model directory (should be created by the user in advance).
  7. n_workers: this is used for a Keras function. It defines the number of threads generating batches in parallel. According to Kera, batches are computed in parallel on the CPU and passed on the fly onto the GPU for neural network computations.

3. Use the default command to run the end-to-end model

The following command trains and evaluates the end-to-end model based on the config file you just edited. To be specific, this command will preprocess the data to convert them into pickle files, then train the model specificed in the config.yml file and finally evaluate the model on testing data.

seq2att default -m config.yml

Note that the -m flag passes the path to the config.yml file to the program.
If you prefer to run those steps one by one so that you have more control over the process, the following commands will produce the same outcome as the default command shown above.

seq2att build -m config.yml
seq2att train -m config.yml

4. Extract the read embedding and attention weights

We recommend you to use our python package to visualize the attention weights because you can have more control over the figure generation. For a quick attention weights extraction in commandline, please use the following command:

seq2att attention -m config.yml -data datafile -taxa taxadata -name taxaname

This command does need the user to prepare additional files. First, datafile is a pickle file that contains X_visual (N by SEQ_LEN by NUMBASE) in numpy array and y_visual (phenotypic labels in integers) in numpy array, taxadata a list of taxonomic labels of those sequences (e.g., genus level labels). taxaname is the name of the taxon of interest. The attention weights will then be extracted and the users can load them in python for downstream analysis. The output is a pickle file that contains four python objects: prediction, attention_weights, sequence_embedding, idx_to_label. To be specific:

  1. prediction: the final dense layer output, $N$ by $N_c$.
  2. attention_weights: the attention weights, $N$ by $L$ by $1$.
  3. sequence_embedding: the sequence level embedding, $N$ by $N_h$.
  4. idx_to_label: maps the dense node index to phenotypic labels. where $N$ is the number of sequences of interest, $N_c$ is the number of phenotypic classes, $L$ is the sequence length, and $N_h$ is the number of hidden nodes in the LSTM layer. The users can use the output file together with the datafile, taxafile to make the visualization as demonstrated in the notebook.

About

No description, website, or topics provided.

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors

Languages

  • Python 100.0%