C implementation of the Burrows-Wheeler Transform and Run-Length Encoding algorithms for the compression of text/FASTA sequences. It is also possible to decompress an already compressed file of sequences.
Simply:
git clone https://github.com/DarkAdin/BWTRLE.git
cd BWTRLE
make
Set DEBUG = 1 in the Makefile if you wish to use a debugger.
./BWTRLE c/d text/FASTA_file
Rows starting with > are ignored in the anaylsis. The program respects the placement of each name, and just outputs the compressed/decompressed sequence that belongs to it in the line below.
- Buffer size:
BUFholds the maximum number of characters per row to allocate in memory. Increase or decrease it to fit your needs. - Alphabet: in the form of
char *alphabet = "¡¿!$'+,.-:;?^_|[]()abcdefghijklmnñopqrstuvwxyz". This variable is important, since it decides the lexical order to follow. Be sure to include all possible characters that the algorithm may encounter, and put them in the lexical order you desire.
Let's say we have this FASTA sequence belonging to a random DNA sequence with its name, in a file called DNA.fasta:
>DNASEQUENCE
ttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgtagaactttttaaaagaggcaaagttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgtagaactttttaaaagaggcaaagttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgtagaactttttaaaagaggcaaagttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgtagaactttttaaaagaggcaaagttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgttagaactttttaaaagaggcaaaggcagaggagaacaaaggaaggaggaagtaacttgtggaatgttgagaaaggtaaaaaccccttcaaataaggaagaggaacaggctatgacctaatgtagaactttttaaaagaggcaaag$
It is very important to have a termination character such as $ at the end of every sequence. If it is absent, the compression is possible but not the decompression.
Compressing it yields a file called compression_results.txt with the same structure as DNA.fasta, with the difference that now the sequence is compressed.
./BWTRLE c DNA.fasta
This is compression_results.txt:
>DNASEQUENCE
g1t10a10t15a10c1a15c20g10c14g20a10t10g15a1g10a15t10a10g10a20g10a14t10g10a30g10a26g20t15a10c10a15g10a20g20a10g15a10c10a34t10a20g1a10g14t10g10a20c10a10c20g10c10a46g10a15g40t20g10a10g10a25g35a40t10a65g10a10t20a4t10g10t15g10a10c10g1t10g4c10t10a10t10g10a5t10a15t15g9$1c10g10c10t30c15
The Burrows-Wheeler Transform for this sequence was computed, and the Run-Length Encoding was applied on it.
This operation took approximately 0.019637 seconds in my machine, compressing 1341 characters into 278 characters, a 20.73% or
This exact file, compression_results.txt can be decompressed to obtain the original sequence/s in a file called decompression_results.txt through:
./BWTRLE d compression_results.txt
There can be any number of sequences in a file, they will all be treated the same way.