The README contains the following directions:
Note that the two provided adapter sequence files contain non-FASTA characters to denote the locations of barcode sequences, which always appear in TruSeq adapters, and may or may not appear in forward and/or reverse reads using the original Solexa/Illumina adapter sequences, depending on library preparation. You'll need to modify the adapter sequence files in order to use them.
But as of commit c5548d1, the adapter file no longer contains the Ns for the barcode, so I am confused as to what I should include in the fasta file. For example, using the barcode CCGTCC, before I would have converted
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC[NNNNNN]ATCTCGTATGCCGTCTTCTGCTTGAAAAA
to
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGTCCATCTCGTATGCCGTCTTCTGCTTGAAAAA
But now the file just contains the sequence prior to the barcode:
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
So do I just add on the 6 bp barcode, or do I additionally need to add the rest of the adapter sequence?
The README contains the following directions:
But as of commit c5548d1, the adapter file no longer contains the Ns for the barcode, so I am confused as to what I should include in the fasta file. For example, using the barcode CCGTCC, before I would have converted
to
But now the file just contains the sequence prior to the barcode:
So do I just add on the 6 bp barcode, or do I additionally need to add the rest of the adapter sequence?