no output

[onceupon]

both count and dump create no output with my fasta files
./BFCounter dump -k 5 -i ~/faireparsed/e16-18hr_faire/macs2.fa -o outfile
help ..

head ~/faireparsed/e16-18hr_faire/macs2.fa

2L:287-539
TCTTATATTACCGCAAACCCAAAAAGACAATACACGACAGAGAGAGAGAGCAGCGGAGATATTTAGATTGCCTATTAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGA
2L:5543-5989
CAAACACAAAATGACAATGCA
....

[pmelsted]

This is an issue with the parsing, BFCounter expects a FASTQ file and doesn't handle FASTA files. If this is not raw sequencing data I would recommend using jellyfish. Also for the low value of k other tools are more appropriate, BFCounter is designed to work when storing all k-mers observed wouldn't fit into memory, something like k=31 for raw data.