") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("total bases: 13683") },
+ { assert snapshot(
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.findAll { key, val -> key.startsWith('versions') }).match() }
+ )
+ }
+ }
+
+ test("test_fastp_single_end_qc_only") {
+
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("single end (151 cycles)") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 99") },
+ { assert snapshot(
+ process.out.reads,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.reads_merged,
+ process.out.findAll { key, val -> key.startsWith('versions') }).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_qc_only") {
+
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("The input has little adapter percentage (~0.000000%), probably it's trimmed before.") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("Q30 bases: 12281(88.3716%)") },
+ { assert snapshot(
+ process.out.reads,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.reads_fail,
+ process.out.reads_merged,
+ process.out.reads_merged,
+ process.out.findAll { key, val -> key.startsWith('versions') }).match() }
+ )
+ }
+ }
+
+ test("test_fastp_single_end - stub") {
+
+ options "-stub"
+
+ when {
+
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end - stub") {
+
+ options "-stub"
+
+ when {
+
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("fastp - stub test_fastp_interleaved") {
+
+ options "-stub"
+
+ config './nextflow.interleaved.config'
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_single_end_trim_fail - stub") {
+
+ options "-stub"
+
+ when {
+
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = true
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_trim_fail - stub") {
+
+ options "-stub"
+
+ config './nextflow.save_failed.config'
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = true
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_merged - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = false
+ save_trimmed_fail = false
+ save_merged = true
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_merged_adapterlist - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ adapter_fasta = file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true)
+ discard_trimmed_pass = false
+ save_trimmed_fail = false
+ save_merged = true
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)
+ ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_single_end_qc_only - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("test_fastp_paired_end_qc_only - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ adapter_fasta = []
+ discard_trimmed_pass = true
+ save_trimmed_fail = false
+ save_merged = false
+
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ],
+ adapter_fasta
+ ])
+ input[1] = discard_trimmed_pass
+ input[2] = save_trimmed_fail
+ input[3] = save_merged
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+}
diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap
new file mode 100644
index 00000000..56772358
--- /dev/null
+++ b/modules/nf-core/fastp/tests/main.nf.test.snap
@@ -0,0 +1,1376 @@
+{
+ "test_fastp_single_end_qc_only - stub": {
+ "content": [
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:52.14535813"
+ },
+ "test_fastp_paired_end": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7",
+ "test_R2.fastp.fastq.gz:md5,25cbdca08e2083dbd4f0502de6b62f39"
+ ]
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:26.421773402"
+ },
+ "test_fastp_paired_end_merged_adapterlist": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_R2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ ]
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ ]
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:59.832295907"
+ },
+ "test_fastp_single_end_qc_only": {
+ "content": [
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:47:06.486959565"
+ },
+ "test_fastp_paired_end_trim_fail": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,6ff32a64c5188b9a9192be1398c262c7",
+ "test_R2.fastp.fastq.gz:md5,db0cb7c9977e94ac2b4b446ebd017a8a"
+ ]
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,409b687c734cedd7a1fec14d316e1366",
+ "test_R1.fail.fastq.gz:md5,4f273cf3159c13f79e8ffae12f5661f6",
+ "test_R2.fail.fastq.gz:md5,f97b9edefb5649aab661fbc9e71fc995"
+ ]
+ ]
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:46.736511024"
+ },
+ "fastp - stub test_fastp_interleaved": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:16.097071654"
+ },
+ "test_fastp_single_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:03.317192706"
+ },
+ "test_fastp_paired_end_merged_adapterlist - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:44.851708205"
+ },
+ "test_fastp_paired_end_merged - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:37.581047713"
+ },
+ "test_fastp_paired_end_merged": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,54b726a55e992a869fd3fa778afe1672",
+ "test_R2.fastp.fastq.gz:md5,29d3b33b869f7b63417b8ff07bb128ba"
+ ]
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.merged.fastq.gz:md5,c873bb1ab3fa859dcc47306465e749d5"
+ ]
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:53.190202914"
+ },
+ "test_fastp_paired_end - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:09.585957282"
+ },
+ "test_fastp_single_end": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:19.624824985"
+ },
+ "test_fastp_single_end_trim_fail - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_fail": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:22.800659826"
+ },
+ "test_fastp_paired_end_trim_fail - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test_R1.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fastp.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_fail": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ [
+ "test.paired.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R1.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_R2.fail.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ]
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:30.271734068"
+ },
+ "fastp test_fastp_interleaved": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,217d62dc13a23e92513a1bd8e1bcea39"
+ ]
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:33.4628687"
+ },
+ "test_fastp_single_end_trim_fail": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastp.fastq.gz:md5,67b2bbae47f073e05a97a9c2edce23c7"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fail.fastq.gz:md5,3e4aaadb66a5b8fc9b881bf39c227abd"
+ ]
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:46:39.895973372"
+ },
+ "test_fastp_paired_end_qc_only": {
+ "content": [
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ {
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:47:13.015833707"
+ },
+ "test_fastp_paired_end_qc_only - stub": {
+ "content": [
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+
+ ],
+ "6": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.fastp.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+
+ ],
+ "reads_fail": [
+
+ ],
+ "reads_merged": [
+
+ ],
+ "versions_fastp": [
+ [
+ "FASTP",
+ "fastp",
+ "1.0.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:00:59.670106791"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/fastp/tests/nextflow.interleaved.config b/modules/nf-core/fastp/tests/nextflow.interleaved.config
new file mode 100644
index 00000000..4be8dbd2
--- /dev/null
+++ b/modules/nf-core/fastp/tests/nextflow.interleaved.config
@@ -0,0 +1,5 @@
+process {
+ withName: FASTP {
+ ext.args = "--interleaved_in -e 30"
+ }
+}
diff --git a/modules/nf-core/fastp/tests/nextflow.save_failed.config b/modules/nf-core/fastp/tests/nextflow.save_failed.config
new file mode 100644
index 00000000..53b61b0c
--- /dev/null
+++ b/modules/nf-core/fastp/tests/nextflow.save_failed.config
@@ -0,0 +1,5 @@
+process {
+ withName: FASTP {
+ ext.args = "-e 30"
+ }
+}
diff --git a/modules/local/nanoq/environment.yml b/modules/nf-core/fastplong/environment.yml
similarity index 84%
rename from modules/local/nanoq/environment.yml
rename to modules/nf-core/fastplong/environment.yml
index 1a95d24e..9fb22e54 100644
--- a/modules/local/nanoq/environment.yml
+++ b/modules/nf-core/fastplong/environment.yml
@@ -4,4 +4,4 @@ channels:
- conda-forge
- bioconda
dependencies:
- - "bioconda::nanoq=0.10.0"
+ - "bioconda::fastplong=0.3.0"
diff --git a/modules/nf-core/fastplong/main.nf b/modules/nf-core/fastplong/main.nf
new file mode 100644
index 00000000..ce1be5ef
--- /dev/null
+++ b/modules/nf-core/fastplong/main.nf
@@ -0,0 +1,62 @@
+process FASTPLONG {
+ tag "$meta.id"
+ label 'process_medium'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://depot.galaxyproject.org/singularity/fastplong:0.3.0--h224cc79_0':
+ 'biocontainers/fastplong:0.3.0--h224cc79_0' }"
+
+ input:
+ tuple val(meta), path(reads)
+ path adapter_fasta
+ val discard_trimmed_pass
+ val save_trimmed_fail
+
+ output:
+ tuple val(meta), path('*.fastplong.fastq.gz') , optional:true, emit: reads
+ tuple val(meta), path('*.json') , emit: json
+ tuple val(meta), path('*.html') , emit: html
+ tuple val(meta), path('*.log') , emit: log
+ tuple val(meta), path('*.fail.fastq.gz') , optional:true, emit: reads_fail
+ tuple val("${task.process}"), val('fastplong'), eval('fastplong --version 2>&1 | sed -e "s/fastplong //g"'), emit: versions_fastplong, topic: versions
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def adapter_list = adapter_fasta ? "--adapter_fasta ${adapter_fasta}" : ""
+ def fail_fastq = save_trimmed_fail ? "--failed_out ${prefix}.fail.fastq.gz" : ''
+ def output_file = discard_trimmed_pass ? '' : "--out ${prefix}.fastplong.fastq.gz"
+ def report_title = task.ext.report_title ?: "${prefix}_fastplong_report"
+ """
+ fastplong \\
+ --in ${reads} \\
+ $output_file \\
+ --json ${prefix}.fastplong.json \\
+ --html ${prefix}.fastplong.html \\
+ $adapter_list \\
+ $fail_fastq \\
+ --thread $task.cpus \\
+ --report_title $report_title\\
+ $args \\
+ 2> >(tee ${prefix}.fastplong.log >&2)
+ """
+
+ stub:
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def touch_reads = discard_trimmed_pass ? "" : "echo '' | gzip > ${prefix}.fastplong.fastq.gz"
+ def touch_fail = save_trimmed_fail ? "echo '' | gzip > ${prefix}.fail.fastq.gz" : ""
+ """
+ echo $args
+
+ $touch_reads
+ $touch_fail
+ touch ${prefix}.fastplong.json
+ touch ${prefix}.fastplong.html
+ touch ${prefix}.fastplong.log
+ """
+}
diff --git a/modules/nf-core/fastplong/meta.yml b/modules/nf-core/fastplong/meta.yml
new file mode 100644
index 00000000..53ebdd58
--- /dev/null
+++ b/modules/nf-core/fastplong/meta.yml
@@ -0,0 +1,126 @@
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
+name: "fastplong"
+description: Perform adapter/quality trimming and QC on long sequencing reads (ONT,
+ PacBio, etc.)
+keywords:
+ - trimming
+ - quality control
+ - fastq
+ - long reads
+tools:
+ - "fastplong":
+ description: "Ultra-fast preprocessing and quality control for long-read sequencing
+ data."
+ homepage: "https://github.com/OpenGene/fastplong/blob/v0.3.0/README.md"
+ documentation: "https://github.com/OpenGene/fastplong/blob/v0.3.0/README.md"
+ tool_dev_url: "https://github.com/OpenGene/fastplong"
+ doi: 10.1002/imt2.107
+ licence: ["MIT"]
+ identifier: biotools:fastplong
+
+input:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information. Use 'single_end: true' for single-end reads.
+ e.g. [ id:'test', single_end:true ]
+ - reads:
+ type: file
+ description: |
+ Input FASTQ file. Gzip-compressed files are supported.
+ pattern: "*.{fastq.gz,fastq}"
+ ontologies:
+ - edam: http://edamontology.org/format_1930 # FASTQ
+ - adapter_fasta:
+ type: file
+ description: |
+ Optional FASTA file containing adapter sequences to trim.
+ pattern: "*.{fasta,fa,fna}"
+ ontologies: []
+ - discard_trimmed_pass:
+ type: boolean
+ description: |
+ If true, no reads that pass trimming thresholds will be written. Only reports will be generated.
+ - save_trimmed_fail:
+ type: boolean
+ description: |
+ If true, reads that fail filtering will be saved to a file ending in `*.fail.fastq.gz`.
+
+output:
+ reads:
+ - - meta:
+ type: map
+ description: Sample information map
+ - "*.fastplong.fastq.gz":
+ type: file
+ description: Trimmed and filtered reads
+ pattern: "*fastplong.fastq.gz"
+ ontologies:
+ - edam: http://edamontology.org/format_1930 # FASTQ
+ - edam: http://edamontology.org/format_3989 # GZIP format
+ json:
+ - - meta:
+ type: map
+ description: Sample information map
+ - "*.json":
+ type: file
+ description: QC report in JSON format
+ pattern: "*.json"
+ ontologies:
+ - edam: http://edamontology.org/format_3464 # JSON
+ html:
+ - - meta:
+ type: map
+ description: Sample information map
+ - "*.html":
+ type: file
+ description: QC report in HTML format
+ pattern: "*.html"
+
+ ontologies: []
+ log:
+ - - meta:
+ type: map
+ description: Sample information map
+ - "*.log":
+ type: file
+ description: Log file generated during trimming
+ pattern: "*.log"
+ ontologies: []
+ reads_fail:
+ - - meta:
+ type: map
+ description: Sample information map
+ - "*.fail.fastq.gz":
+ type: file
+ description: Reads that failed quality/trimming filters
+ pattern: "*fail.fastq.gz"
+ ontologies:
+ - edam: http://edamontology.org/format_1930 # FASTQ
+ - edam: http://edamontology.org/format_3989 # GZIP format
+ versions_fastplong:
+ - - "${task.process}":
+ type: string
+ description: The name of the process
+ - fastplong:
+ type: string
+ description: The name of the tool
+ - 'fastplong --version 2>&1 | sed -e "s/fastplong //g"':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - "${task.process}":
+ type: string
+ description: The name of the process
+ - fastplong:
+ type: string
+ description: The name of the tool
+ - 'fastplong --version 2>&1 | sed -e "s/fastplong //g"':
+ type: eval
+ description: The expression to obtain the version of the tool
+authors:
+ - "@Lupphes"
+ - "@eit-maxlcummins"
+maintainers:
+ - "@Lupphes"
diff --git a/modules/nf-core/fastplong/tests/main.nf.test b/modules/nf-core/fastplong/tests/main.nf.test
new file mode 100644
index 00000000..4f545c90
--- /dev/null
+++ b/modules/nf-core/fastplong/tests/main.nf.test
@@ -0,0 +1,70 @@
+nextflow_process {
+
+ name "Test Process FASTPLONG"
+ script "../main.nf"
+ process "FASTPLONG"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "fastplong"
+
+
+ test("test_fastplong - pacbio") {
+
+ when {
+
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'alz.ccs', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq.gz', checkIfExists: true), ]
+ ])
+ input[1] = []
+ input[2] = false
+ input[3] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert path(process.out.html.get(0).get(1)).getText().contains("
total bases: 272.128000 K ") },
+ { assert path(process.out.log.get(0).get(1)).getText().contains("reads passed filter: 100") },
+ { assert snapshot(
+ process.out.json,
+ process.out.reads,
+ process.out.reads_fail,
+ process.out.findAll { key, val -> key.startsWith('versions') }).match() }
+ )
+ }
+ }
+
+ test("test_fastplong - pacbio - stub") {
+
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:true ],
+ [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq.gz', checkIfExists: true), ]
+ ])
+ input[1] = []
+ input[2] = false
+ input[3] = false
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+
+ }
+
+}
diff --git a/modules/nf-core/fastplong/tests/main.nf.test.snap b/modules/nf-core/fastplong/tests/main.nf.test.snap
new file mode 100644
index 00000000..041c9b49
--- /dev/null
+++ b/modules/nf-core/fastplong/tests/main.nf.test.snap
@@ -0,0 +1,144 @@
+{
+ "test_fastplong - pacbio": {
+ "content": [
+ [
+ [
+ {
+ "id": "alz.ccs",
+ "single_end": true
+ },
+ "alz.ccs.fastplong.json:md5,2bead4f1ec7984bf16de054f610befd7"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "alz.ccs",
+ "single_end": true
+ },
+ "alz.ccs.fastplong.fastq.gz:md5,23a6d8f301d0fd4d2da21f86ff0afac6"
+ ]
+ ],
+ [
+
+ ],
+ {
+ "versions_fastplong": [
+ [
+ "FASTPLONG",
+ "fastplong",
+ "0.3.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-23T09:48:16.59023584"
+ },
+ "test_fastplong - pacbio - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+
+ ],
+ "5": [
+ [
+ "FASTPLONG",
+ "fastplong",
+ "0.3.0"
+ ]
+ ],
+ "html": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.html:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "json": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.json:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "reads": [
+ [
+ {
+ "id": "test",
+ "single_end": true
+ },
+ "test.fastplong.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ "reads_fail": [
+
+ ],
+ "versions_fastplong": [
+ [
+ "FASTPLONG",
+ "fastplong",
+ "0.3.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-01-22T13:04:24.553785802"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf
index 23e16634..f5629527 100644
--- a/modules/nf-core/fastqc/main.nf
+++ b/modules/nf-core/fastqc/main.nf
@@ -1,6 +1,6 @@
process FASTQC {
tag "${meta.id}"
- label 'process_medium'
+ label 'process_low'
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
@@ -11,9 +11,9 @@ process FASTQC {
tuple val(meta), path(reads)
output:
- tuple val(meta), path("*.html"), emit: html
- tuple val(meta), path("*.zip") , emit: zip
- path "versions.yml" , emit: versions
+ tuple val(meta) , path("*.html") , emit: html
+ tuple val(meta) , path("*.zip") , emit: zip
+ tuple val("${task.process}"), val('fastqc'), eval('fastqc --version | sed "/FastQC v/!d; s/.*v//"'), emit: versions_fastqc, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -43,11 +43,6 @@ process FASTQC {
--threads ${task.cpus} \\
--memory ${fastqc_memory} \\
${renamed_files}
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
- END_VERSIONS
"""
stub:
@@ -55,10 +50,5 @@ process FASTQC {
"""
touch ${prefix}.html
touch ${prefix}.zip
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' )
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml
deleted file mode 100644
index c8d9d025..00000000
--- a/modules/nf-core/fastqc/meta.yml
+++ /dev/null
@@ -1,72 +0,0 @@
-name: fastqc
-description: Run FastQC on sequenced reads
-keywords:
- - quality control
- - qc
- - adapters
- - fastq
-tools:
- - fastqc:
- description: |
- FastQC gives general quality metrics about your reads.
- It provides information about the quality score distribution
- across your reads, the per base sequence content (%A/C/G/T).
-
- You get information about adapter contamination and other
- overrepresented sequences.
- homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
- documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/
- licence: ["GPL-2.0-only"]
- identifier: biotools:fastqc
-input:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: |
- List of input FastQ files of size 1 and 2 for single-end and paired-end data,
- respectively.
- ontologies: []
-output:
- html:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*.html":
- type: file
- description: FastQC report
- pattern: "*_{fastqc.html}"
- ontologies: []
- zip:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*.zip":
- type: file
- description: FastQC report archive
- pattern: "*_{fastqc.zip}"
- ontologies: []
- versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
- ontologies:
- - edam: http://edamontology.org/format_3750 # YAML
-authors:
- - "@drpatelh"
- - "@grst"
- - "@ewels"
- - "@FelixKrueger"
-maintainers:
- - "@drpatelh"
- - "@grst"
- - "@ewels"
- - "@FelixKrueger"
diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test
deleted file mode 100644
index e9d79a07..00000000
--- a/modules/nf-core/fastqc/tests/main.nf.test
+++ /dev/null
@@ -1,309 +0,0 @@
-nextflow_process {
-
- name "Test Process FASTQC"
- script "../main.nf"
- process "FASTQC"
-
- tag "modules"
- tag "modules_nfcore"
- tag "fastqc"
-
- test("sarscov2 single-end [fastq]") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [ id: 'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it.
- // looks like this:
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 paired-end [fastq]") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
- { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
- { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
- { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
- { assert path(process.out.html[0][1][0]).text.contains("
File type Conventional base calls ") },
- { assert path(process.out.html[0][1][1]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 interleaved [fastq]") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 paired-end [bam]") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 multiple [fastq]") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" },
- { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" },
- { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" },
- { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" },
- { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" },
- { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" },
- { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" },
- { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" },
- { assert path(process.out.html[0][1][0]).text.contains("
File type Conventional base calls ") },
- { assert path(process.out.html[0][1][1]).text.contains("
File type Conventional base calls ") },
- { assert path(process.out.html[0][1][2]).text.contains("
File type Conventional base calls ") },
- { assert path(process.out.html[0][1][3]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 custom_prefix") {
-
- when {
- process {
- """
- input[0] = Channel.of([
- [ id:'mysample', single_end:true ], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" },
- { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" },
- { assert path(process.out.html[0][1]).text.contains("
File type Conventional base calls ") },
- { assert snapshot(process.out.versions).match() }
- )
- }
- }
-
- test("sarscov2 single-end [fastq] - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [ id: 'test', single_end:true ],
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-
- test("sarscov2 paired-end [fastq] - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-
- test("sarscov2 interleaved [fastq] - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-
- test("sarscov2 paired-end [bam] - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-
- test("sarscov2 multiple [fastq] - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [id: 'test', single_end: false], // meta map
- [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true),
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ]
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-
- test("sarscov2 custom_prefix - stub") {
-
- options "-stub"
- when {
- process {
- """
- input[0] = Channel.of([
- [ id:'mysample', single_end:true ], // meta map
- file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)
- ])
- """
- }
- }
-
- then {
- assertAll (
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
- }
-}
diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap
deleted file mode 100644
index d5db3092..00000000
--- a/modules/nf-core/fastqc/tests/main.nf.test.snap
+++ /dev/null
@@ -1,392 +0,0 @@
-{
- "sarscov2 custom_prefix": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:16.374038"
- },
- "sarscov2 single-end [fastq] - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:24.993809"
- },
- "sarscov2 custom_prefix - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "mysample",
- "single_end": true
- },
- "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "mysample",
- "single_end": true
- },
- "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "mysample",
- "single_end": true
- },
- "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "mysample",
- "single_end": true
- },
- "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:03:10.93942"
- },
- "sarscov2 interleaved [fastq]": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:01:42.355718"
- },
- "sarscov2 paired-end [bam]": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:01:53.276274"
- },
- "sarscov2 multiple [fastq]": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:05.527626"
- },
- "sarscov2 paired-end [fastq]": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:01:31.188871"
- },
- "sarscov2 paired-end [fastq] - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:34.273566"
- },
- "sarscov2 multiple [fastq] - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:03:02.304411"
- },
- "sarscov2 single-end [fastq]": {
- "content": [
- [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:01:19.095607"
- },
- "sarscov2 interleaved [fastq] - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:44.640184"
- },
- "sarscov2 paired-end [bam] - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "html": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.html:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,e1cc25ca8af856014824abd842e93978"
- ],
- "zip": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.3"
- },
- "timestamp": "2024-07-22T11:02:53.550742"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/flye/main.nf b/modules/nf-core/flye/main.nf
index fecab194..9da156e3 100644
--- a/modules/nf-core/flye/main.nf
+++ b/modules/nf-core/flye/main.nf
@@ -18,7 +18,7 @@ process FLYE {
tuple val(meta), path("*.txt") , emit: txt
tuple val(meta), path("*.log") , emit: log
tuple val(meta), path("*.json") , emit: json
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('flye'), eval('flye --version'), emit: versions_flye, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -43,11 +43,6 @@ process FLYE {
mv assembly_info.txt ${prefix}.assembly_info.txt
mv flye.log ${prefix}.flye.log
mv params.json ${prefix}.params.json
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- flye: \$( flye --version )
- END_VERSIONS
"""
stub:
@@ -59,10 +54,5 @@ process FLYE {
echo contig_1 > ${prefix}.assembly_info.txt
echo stub > ${prefix}.flye.log
echo stub > ${prefix}.params.json
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- flye: \$( flye --version )
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/flye/meta.yml b/modules/nf-core/flye/meta.yml
index 1e33c275..f77f4885 100644
--- a/modules/nf-core/flye/meta.yml
+++ b/modules/nf-core/flye/meta.yml
@@ -24,16 +24,18 @@ input:
e.g. [ id:'test' ]
- reads:
type: file
- description: Input reads from Oxford Nanopore or PacBio data in FASTA/FASTQ
- format.
+ description: Input reads from Oxford Nanopore or PacBio data in
+ FASTA/FASTQ format.
pattern: "*.{fasta,fastq,fasta.gz,fastq.gz,fa,fq,fa.gz,fq.gz}"
- - - mode:
- type: string
- description: Flye mode depending on the input data (source and error rate)
- pattern: "--pacbio-raw|--pacbio-corr|--pacbio-hifi|--nano-raw|--nano-corr|--nano-hq"
+ ontologies:
+ - edam: http://edamontology.org/format_1930 # FASTQ
+ - mode:
+ type: string
+ description: Flye mode depending on the input data (source and error rate)
+ pattern: "--pacbio-raw|--pacbio-corr|--pacbio-hifi|--nano-raw|--nano-corr|--nano-hq"
output:
- - fasta:
- - meta:
+ fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -42,8 +44,10 @@ output:
type: file
description: Assembled FASTA file
pattern: "*.fasta.gz"
- - gfa:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989 # GZIP format
+ gfa:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -52,8 +56,10 @@ output:
type: file
description: Repeat graph in gfa format
pattern: "*.gfa.gz"
- - gv:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989 # GZIP format
+ gv:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -62,8 +68,10 @@ output:
type: file
description: Repeat graph in gv format
pattern: "*.gv.gz"
- - txt:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989 # GZIP format
+ txt:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -72,8 +80,9 @@ output:
type: file
description: Extra information and statistics about resulting contigs
pattern: "*.txt"
- - log:
- - meta:
+ ontologies: []
+ log:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -82,8 +91,9 @@ output:
type: file
description: Flye log file
pattern: "*.log"
- - json:
- - meta:
+ ontologies: []
+ json:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -92,11 +102,31 @@ output:
type: file
description: Flye parameters
pattern: "*.json"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3464 # JSON
+ versions_flye:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - flye:
+ type: string
+ description: The name of the tool
+ - flye --version:
+ type: eval
+ description: The expression to obtain the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - flye:
+ type: string
+ description: The name of the tool
+ - flye --version:
+ type: eval
+ description: The expression to obtain the version of the tool
+
authors:
- "@mirpedrol"
maintainers:
diff --git a/modules/nf-core/flye/tests/main.nf.test b/modules/nf-core/flye/tests/main.nf.test
index afbf926e..e173518e 100644
--- a/modules/nf-core/flye/tests/main.nf.test
+++ b/modules/nf-core/flye/tests/main.nf.test
@@ -38,7 +38,7 @@ nextflow_process {
file(process.out.txt.get(0).get(1)).name,
path(process.out.txt.get(0).get(1)).readLines()[1].contains("contig_1"),
process.out.json,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -72,7 +72,7 @@ nextflow_process {
file(process.out.txt.get(0).get(1)).name,
path(process.out.txt.get(0).get(1)).readLines()[1].contains("contig_1"),
process.out.json,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -106,7 +106,7 @@ nextflow_process {
file(process.out.txt.get(0).get(1)).name,
path(process.out.txt.get(0).get(1)).readLines()[1].contains("contig_1"),
process.out.json,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -140,7 +140,7 @@ nextflow_process {
file(process.out.txt.get(0).get(1)).name,
path(process.out.txt.get(0).get(1)).readLines()[1].contains("contig_1"),
process.out.json,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -167,7 +167,7 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
process.out,
- path(process.out.versions.get(0)).yaml
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match()
}
)
diff --git a/modules/nf-core/flye/tests/main.nf.test.snap b/modules/nf-core/flye/tests/main.nf.test.snap
index 7101f9ed..ed22fa9d 100644
--- a/modules/nf-core/flye/tests/main.nf.test.snap
+++ b/modules/nf-core/flye/tests/main.nf.test.snap
@@ -15,15 +15,21 @@
"test.params.json:md5,54b576cb6d4d27656878a7fd3657bde9"
]
],
- [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
- ]
+ {
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T13:41:09.075217"
+ "timestamp": "2026-01-22T13:55:32.315805611"
},
"flye_pacbio_corr": {
"content": [
@@ -41,15 +47,21 @@
"test.params.json:md5,54b576cb6d4d27656878a7fd3657bde9"
]
],
- [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
- ]
+ {
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T13:33:16.267658"
+ "timestamp": "2026-01-22T13:54:05.452301952"
},
"flye_nano_corr": {
"content": [
@@ -67,15 +79,21 @@
"test.params.json:md5,54b576cb6d4d27656878a7fd3657bde9"
]
],
- [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
- ]
+ {
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T13:44:28.522592"
+ "timestamp": "2026-01-22T13:58:20.270302808"
},
"flye_nano_hq": {
"content": [
@@ -93,15 +111,21 @@
"test.params.json:md5,54b576cb6d4d27656878a7fd3657bde9"
]
],
- [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
- ]
+ {
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T13:46:35.912198"
+ "timestamp": "2026-01-22T14:00:09.061930982"
},
"flye_pacbio_raw - stub": {
"content": [
@@ -155,7 +179,11 @@
]
],
"6": [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
],
"fasta": [
[
@@ -205,20 +233,28 @@
"test.assembly_info.txt:md5,e3aec731279050302fc8d6f126b3030e"
]
],
- "versions": [
- "versions.yml:md5,80496e451401dbc0269ec404801a90e3"
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
]
},
{
- "FLYE": {
- "flye": "2.9.5-b1801"
- }
+ "versions_flye": [
+ [
+ "FLYE",
+ "flye",
+ "2.9.5-b1801"
+ ]
+ ]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-12T09:07:05.234775"
+ "timestamp": "2026-01-22T14:00:16.619909915"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/hifiasm/main.nf b/modules/nf-core/hifiasm/main.nf
index 7330920e..65d98df7 100644
--- a/modules/nf-core/hifiasm/main.nf
+++ b/modules/nf-core/hifiasm/main.nf
@@ -24,7 +24,8 @@ process HIFIASM {
tuple val(meta), path("*.ec.fa.gz") , emit: corrected_reads , optional: true
tuple val(meta), path("*.ovlp.paf.gz") , emit: read_overlaps , optional: true
tuple val(meta), path("${prefix}.stderr.log") , emit: log
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('hifasm'), eval('hifiasm --version 2>&1'), emit: versions_hifiasm, topic: versions
+
when:
task.ext.when == null || task.ext.when
@@ -33,8 +34,8 @@ process HIFIASM {
def args = task.ext.args ?: ''
prefix = task.ext.prefix ?: "${meta.id}"
- def long_reads_sorted = long_reads instanceof List ? long_reads.sort{ it.name } : long_reads
- def ul_reads_sorted = ul_reads instanceof List ? ul_reads.sort{ it.name } : ul_reads
+ def long_reads_sorted = long_reads instanceof List ? long_reads.sort{ read -> read.name } : long_reads
+ def ul_reads_sorted = ul_reads instanceof List ? ul_reads.sort{ read -> read.name } : ul_reads
def ultralong = ul_reads ? "--ul ${ul_reads_sorted}" : ""
if([paternal_kmer_dump, maternal_kmer_dump].any() && [hic_read1, hic_read2].any()) {
@@ -67,7 +68,7 @@ process HIFIASM {
${ultralong} \\
-o ${prefix} \\
${long_reads_sorted} \\
- 2> >( tee ${prefix}.stderr.log >&2 )
+ 2>| >( tee ${prefix}.stderr.log >&2 )
if [ -f ${prefix}.ec.fa ]; then
gzip ${prefix}.ec.fa
@@ -76,11 +77,6 @@ process HIFIASM {
if [ -f ${prefix}.ovlp.paf ]; then
gzip ${prefix}.ovlp.paf
fi
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- hifiasm: \$(hifiasm --version 2>&1)
- END_VERSIONS
"""
stub:
@@ -101,10 +97,5 @@ process HIFIASM {
echo "" | gzip > ${prefix}.ec.fa.gz
echo "" | gzip > ${prefix}.ovlp.paf.gz
touch ${prefix}.stderr.log
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- hifiasm: \$(hifiasm --version 2>&1)
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/hifiasm/meta.yml b/modules/nf-core/hifiasm/meta.yml
index fcd211db..61a9a997 100644
--- a/modules/nf-core/hifiasm/meta.yml
+++ b/modules/nf-core/hifiasm/meta.yml
@@ -14,7 +14,8 @@ tools:
documentation: https://github.com/chhylp123/hifiasm
tool_dev_url: https://github.com/chhylp123/hifiasm
doi: "10.1038/s41592-020-01056-5"
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:hifiasm
input:
- - meta:
@@ -24,7 +25,8 @@ input:
e.g. [ id:'test', single_end:false ]
- long_reads:
type: file
- description: Long reads PacBio HiFi reads or ONT reads (requires ext.arg '--ont').
+ description: Long reads PacBio HiFi reads or ONT reads (requires ext.arg
+ '--ont').
ontologies: []
- ul_reads:
type: file
@@ -36,13 +38,13 @@ input:
Groovy Map containing information about parental kmers.
- paternal_kmer_dump:
type: file
- description: Yak kmer dump file for paternal reads (can be used for haplotype
- resolution). It can have an arbitrary extension.
+ description: Yak kmer dump file for paternal reads (can be used for
+ haplotype resolution). It can have an arbitrary extension.
ontologies: []
- maternal_kmer_dump:
type: file
- description: Yak kmer dump file for maternal reads (can be used for haplotype
- resolution). It can have an arbitrary extension.
+ description: Yak kmer dump file for maternal reads (can be used for
+ haplotype resolution). It can have an arbitrary extension.
ontologies: []
- - meta2:
type: map
@@ -65,8 +67,8 @@ input:
description: bin files produced during a previous Hifiasm run
ontologies: []
output:
- - raw_unitigs:
- - meta:
+ raw_unitigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -75,8 +77,10 @@ output:
type: file
description: Raw unitigs
pattern: "*.r_utg.gfa"
- - bin_files:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3975
+ bin_files:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -91,8 +95,9 @@ output:
initial results, which are the most computationally-expensive
steps.
pattern: "*.bin"
- - processed_unitigs:
- - meta:
+ ontologies: []
+ processed_unitigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -101,8 +106,10 @@ output:
type: file
description: Processed unitigs
pattern: "*.p_utg.gfa"
- - primary_contigs:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3975
+ primary_contigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -111,8 +118,9 @@ output:
type: file
description: Contigs representing the primary assembly
pattern: "${prefix}.{p_ctg,bp.p_ctg,hic.p_ctg}.gfa"
- - alternate_contigs:
- - meta:
+ ontologies: []
+ alternate_contigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -121,13 +129,13 @@ output:
type: file
description: Contigs representing the alternative assembly
pattern: "${prefix}.{a_ctg,hic.a_ctg}.gfa"
- - hap1_contigs:
- - meta:
+ ontologies: []
+ hap1_contigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- pattern: "${prefix}.*.hap1.p_ctg.gfa"
- ${prefix}.*.hap1.p_ctg.gfa:
type: file
description: |
@@ -138,13 +146,13 @@ output:
between contigs. In trio mode, they are fully phased paternal contigs
all originating from a single parental haplotype.
pattern: "${prefix}.*.hap1.p_ctg.gfa"
- - hap2_contigs:
- - meta:
+ ontologies: []
+ hap2_contigs:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- pattern: "${prefix}.*.hap2.p_ctg.gfa"
- ${prefix}.*.hap2.p_ctg.gfa:
type: file
description: |
@@ -155,8 +163,9 @@ output:
between contigs. In trio mode, they are fully phased paternal contigs
all originating from a single parental haplotype.
pattern: "${prefix}.*.hap2.p_ctg.gfa"
- - corrected_reads:
- - meta:
+ ontologies: []
+ corrected_reads:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -167,8 +176,10 @@ output:
If option --write-ec specified, a gzipped fasta file containing the error corrected
reads produced by the hifiasm error correction module
pattern: "*.ec.fa.gz"
- - read_overlaps:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989
+ read_overlaps:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -179,23 +190,40 @@ output:
If option --write-paf specified, a gzipped paf file describing the overlaps
among all error-corrected reads
pattern: "*.ovlp.paf.gz"
- - log:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989
+ log:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- pattern: "*.stderr.log"
- ${prefix}.stderr.log:
type: file
description: Stderr log
pattern: "*.stderr.log"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
ontologies: []
+ versions_hifiasm:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - hifasm:
+ type: string
+ description: The name of the tool
+ - hifiasm --version 2>&1:
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - hifasm:
+ type: string
+ description: The name of the tool
+ - hifiasm --version 2>&1:
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@sidorov-si"
- "@scorreard"
diff --git a/modules/nf-core/hifiasm/tests/main.nf.test b/modules/nf-core/hifiasm/tests/main.nf.test
index 53edf404..d158847b 100644
--- a/modules/nf-core/hifiasm/tests/main.nf.test
+++ b/modules/nf-core/hifiasm/tests/main.nf.test
@@ -59,7 +59,7 @@ nextflow_process {
process.out.hap2_contigs,
process.out.fasta,
process.out.paf,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -133,7 +133,7 @@ nextflow_process {
process.out.primary_contigs,
process.out.hap1_contigs,
process.out.hap2_contigs,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -191,7 +191,7 @@ nextflow_process {
process.out.primary_contigs,
process.out.hap1_contigs,
process.out.hap2_contigs,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -249,7 +249,7 @@ nextflow_process {
process.out.raw_unitigs,
process.out.processed_unitigs,
process.out.hap1_contigs,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -309,7 +309,7 @@ nextflow_process {
process.out.primary_contigs,
process.out.alternate_contigs,
process.out.hap1_contigs,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -455,4 +455,4 @@ nextflow_process {
)
}
}
-}
\ No newline at end of file
+}
diff --git a/modules/nf-core/hifiasm/tests/main.nf.test.snap b/modules/nf-core/hifiasm/tests/main.nf.test.snap
index cf8a7eba..044a6dbb 100644
--- a/modules/nf-core/hifiasm/tests/main.nf.test.snap
+++ b/modules/nf-core/hifiasm/tests/main.nf.test.snap
@@ -36,15 +36,21 @@
"test.hic.hap1.p_ctg.gfa:md5,f67a8fdfa756961360732c79d189054d"
]
],
- [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
- ]
+ {
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T15:34:30.534362903",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-15T14:24:48.67437687"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo_sapiens pacbio hifi [fastq, [,], [,], [bin] ]": {
"content": [
@@ -88,15 +94,21 @@
"test.bp.hap2.p_ctg.gfa:md5,ac2116fd2f22c67d4c304cbf9b9f7793"
]
],
- [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
- ]
+ {
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T16:19:44.451598985",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-15T14:24:20.599937477"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"homo_sapiens pacbio hifi [fastq x2, [,], [,], [,] ]": {
"content": [
@@ -140,15 +152,21 @@
"test.bp.hap2.p_ctg.gfa:md5,ce096a66c9bba039c6a22ba9e9409d01"
]
],
- [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
- ]
+ {
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T16:19:55.227290441",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-15T14:24:28.744387853"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"homo_sapiens pacbio hifi [fastq, [,], [,], [,] ] - stub": {
"content": [
@@ -176,7 +194,11 @@
]
],
"10": [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
],
"2": [
[
@@ -334,16 +356,20 @@
"test.ovlp.paf.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
],
- "versions": [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
]
}
],
+ "timestamp": "2026-02-16T10:53:50.939408883",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-17T15:56:54.410648332"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo_sapiens pacbio hifi [fastq, [,], [,], [,]]": {
"content": [
@@ -389,15 +415,21 @@
],
null,
null,
- [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
- ]
+ {
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T10:52:36.945051713",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-15T14:24:12.033205578"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo_sapiens pacbio hifi [fastq, [yak, yak], [,], [,] ]": {
"content": [
@@ -425,14 +457,20 @@
"test.dip.hap1.p_ctg.gfa:md5,eed5da5f3dd415dbb711edb61a09802f"
]
],
- [
- "versions.yml:md5,b7828129854c24ce80a025f90bf3f557"
- ]
+ {
+ "versions_hifiasm": [
+ [
+ "HIFIASM",
+ "hifasm",
+ "0.25.0-r726"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T16:20:05.943561958",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-04-15T14:24:37.330378652"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/liftoff/main.nf b/modules/nf-core/liftoff/main.nf
index 649e4ba4..dec05984 100644
--- a/modules/nf-core/liftoff/main.nf
+++ b/modules/nf-core/liftoff/main.nf
@@ -15,7 +15,7 @@ process LIFTOFF {
tuple val(meta), path("${prefix}.gff3") , emit: gff3
tuple val(meta), path("*.polished.gff3") , emit: polished_gff3, optional: true
tuple val(meta), path("*.unmapped.txt") , emit: unmapped_txt
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('liftoff'), eval('liftoff --version | sed "s/v//"'), emit: versions_liftoff, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -56,11 +56,6 @@ process LIFTOFF {
"${prefix}.gff3_polished" \\
"${prefix}.polished.gff3" \\
|| echo "-polish is absent"
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- liftoff: \$(liftoff --version 2> /dev/null)
- END_VERSIONS
"""
stub:
@@ -71,10 +66,5 @@ process LIFTOFF {
touch "${prefix}.gff3"
touch "${prefix}.unmapped.txt"
$touch_polished
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- liftoff: \$(liftoff --version 2> /dev/null)
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/liftoff/meta.yml b/modules/nf-core/liftoff/meta.yml
index 7d809f7f..35efaf78 100644
--- a/modules/nf-core/liftoff/meta.yml
+++ b/modules/nf-core/liftoff/meta.yml
@@ -1,4 +1,3 @@
-# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
name: "liftoff"
description: |
Uses Liftoff to accurately map annotations in GFF or GTF between assemblies of the same,
@@ -18,7 +17,8 @@ tools:
documentation: "https://github.com/agshumate/Liftoff"
tool_dev_url: "https://github.com/agshumate/Liftoff"
doi: "10.1093/bioinformatics/bty191"
- licence: ["GPL v3 License"]
+ licence:
+ - "GPL v3 License"
identifier: biotools:liftoff
input:
- - meta:
@@ -30,22 +30,26 @@ input:
type: file
description: Target assembly in fasta format (can be gzipped)
pattern: "*.{fa,fa.gz,fasta,fasta.gz,fas,fas.gz,fsa,fsa.gz}"
- - - ref_fa:
- type: file
- description: Reference assembly in fasta format (can be gzipped)
- pattern: "*.{fa,fa.gz,fasta,fasta.gz,fas,fas.gz,fsa,fsa.gz}"
- - - ref_annotation:
- type: file
- description: Reference assembly annotations in gtf or gff3 format
- pattern: "*.{gtf,gff3}"
- - - ref_db:
- type: file
- description: |
- Name of feature database; if not specified, the -g argument must
- be provided and a database will be built automatically
+ ontologies: []
+ - ref_fa:
+ type: file
+ description: Reference assembly in fasta format (can be gzipped)
+ pattern: "*.{fa,fa.gz,fasta,fasta.gz,fas,fas.gz,fsa,fsa.gz}"
+ ontologies: []
+ - ref_annotation:
+ type: file
+ description: Reference assembly annotations in gtf or gff3 format
+ pattern: "*.{gtf,gff3}"
+ ontologies: []
+ - ref_db:
+ type: file
+ description: |
+ Name of feature database; if not specified, the -g argument must
+ be provided and a database will be built automatically
+ ontologies: []
output:
- - gff3:
- - meta:
+ gff3:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -54,18 +58,21 @@ output:
type: file
description: Lifted annotations for the target assembly in gff3 format
pattern: "*.gff3"
- - polished_gff3:
- - meta:
+ ontologies: []
+ polished_gff3:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. `[ id:'test' ]`
- "*.polished.gff3":
type: file
- description: Polished lifted annotations for the target assembly in gff3 format
+ description: Polished lifted annotations for the target assembly in gff3
+ format
pattern: "*.polished.gff3"
- - unmapped_txt:
- - meta:
+ ontologies: []
+ unmapped_txt:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -74,11 +81,28 @@ output:
type: file
description: List of unmapped reference annotations
pattern: "*.unmapped.txt"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_liftoff:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - liftoff:
+ type: string
+ description: The name of the tool
+ - liftoff --version | sed "s/v//":
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - liftoff:
+ type: string
+ description: The name of the tool
+ - liftoff --version | sed "s/v//":
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@GallVp"
maintainers:
diff --git a/modules/nf-core/liftoff/tests/main.nf.test b/modules/nf-core/liftoff/tests/main.nf.test
index 2a17cc81..bdc705a0 100644
--- a/modules/nf-core/liftoff/tests/main.nf.test
+++ b/modules/nf-core/liftoff/tests/main.nf.test
@@ -34,9 +34,9 @@ nextflow_process {
assertAll(
{ assert process.success },
{ assert snapshot(process.out.unmapped_txt).match("unmapped_txt") },
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith('versions') }).match() },
{ assert file(process.out.gff3[0][1]).text.contains("chr21\tLiftoff\texon\t34608061\t34608118\t.\t+\t.") },
{ assert file(process.out.polished_gff3[0][1]).text.contains("chr21\tLiftoff\texon\t34608061\t34608118\t.\t+\t.") },
- { assert snapshot(process.out.versions).match("versions") }
)
}
@@ -52,8 +52,8 @@ nextflow_process {
[ id:'test' ],
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true)
]
- input[1] = [
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr1/genome.fasta.gz', checkIfExists: true)
+ input[1] = [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr1/genome.fasta.gz', checkIfExists: true)
]
input[2] = [
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr1/genome.gtf', checkIfExists: true)
diff --git a/modules/nf-core/liftoff/tests/main.nf.test.snap b/modules/nf-core/liftoff/tests/main.nf.test.snap
index f6064467..545f8ab3 100644
--- a/modules/nf-core/liftoff/tests/main.nf.test.snap
+++ b/modules/nf-core/liftoff/tests/main.nf.test.snap
@@ -10,23 +10,29 @@
]
]
],
+ "timestamp": "2023-12-01T13:57:40.748507",
"meta": {
"nf-test": "0.8.4",
"nextflow": "23.10.1"
- },
- "timestamp": "2023-12-01T13:57:40.748507"
+ }
},
- "versions": {
+ "homo_sapiens-genome_21_fasta-genome_1_fasta-genome_1_gtf": {
"content": [
- [
- "versions.yml:md5,205d9c609e7fe27d8199550d842bdce8"
- ]
+ {
+ "versions_liftoff": [
+ [
+ "LIFTOFF",
+ "liftoff",
+ "1.6.3"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T17:56:04.622385608",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2023-12-01T13:57:40.752414"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"homo_sapiens-genome_21_fasta-genome_1_fasta-genome_1_gtf-stub": {
"content": [
@@ -56,7 +62,11 @@
]
],
"3": [
- "versions.yml:md5,205d9c609e7fe27d8199550d842bdce8"
+ [
+ "LIFTOFF",
+ "liftoff",
+ "1.6.3"
+ ]
],
"gff3": [
[
@@ -82,15 +92,19 @@
"test.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,205d9c609e7fe27d8199550d842bdce8"
+ "versions_liftoff": [
+ [
+ "LIFTOFF",
+ "liftoff",
+ "1.6.3"
+ ]
]
}
],
+ "timestamp": "2026-02-16T17:56:15.752736312",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-19T09:15:25.661428"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/lima/main.nf b/modules/nf-core/lima/main.nf
deleted file mode 100644
index e5b334b1..00000000
--- a/modules/nf-core/lima/main.nf
+++ /dev/null
@@ -1,82 +0,0 @@
-process LIMA {
- tag "$meta.id"
- label 'process_low'
-
- conda "${moduleDir}/environment.yml"
- container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/lima:2.12.0--h9ee0642_1' :
- 'biocontainers/lima:2.12.0--h9ee0642_1' }"
-
- input:
- tuple val(meta), path(ccs)
- path primers
-
- output:
- tuple val(meta), path("*.counts") , emit: counts
- tuple val(meta), path("*.report") , emit: report
- tuple val(meta), path("*.summary"), emit: summary
- path "versions.yml" , emit: versions
-
- tuple val(meta), path("*.bam") , optional: true, emit: bam
- tuple val(meta), path("*.bam.pbi") , optional: true, emit: pbi
- tuple val(meta), path("*.{fa, fasta}") , optional: true, emit: fasta
- tuple val(meta), path("*.{fa.gz, fasta.gz}"), optional: true, emit: fastagz
- tuple val(meta), path("*.fastq") , optional: true, emit: fastq
- tuple val(meta), path("*.fastq.gz") , optional: true, emit: fastqgz
- tuple val(meta), path("*.xml") , optional: true, emit: xml
- tuple val(meta), path("*.json") , optional: true, emit: json
- tuple val(meta), path("*.clips") , optional: true, emit: clips
- tuple val(meta), path("*.guess") , optional: true, emit: guess
-
- when:
- task.ext.when == null || task.ext.when
-
- script:
- def args = task.ext.args ?: ''
- def prefix = task.ext.prefix ?: "${meta.id}"
- if( "$ccs" == "${prefix}.bam" ) error "Input and output names are the same, set prefix in module configuration"
- if( "$ccs" == "${prefix}.fasta" ) error "Input and output names are the same, set prefix in module configuration"
- if( "$ccs" == "${prefix}.fasta.gz" ) error "Input and output names are the same, set prefix in module configuration"
- if( "$ccs" == "${prefix}.fastq" ) error "Input and output names are the same, set prefix in module configuration"
- if( "$ccs" == "${prefix}.fastq.gz" ) error "Input and output names are the same, set prefix in module configuration"
-
- """
- OUT_EXT=""
-
- if [[ $ccs =~ bam\$ ]]; then
- OUT_EXT="bam"
- elif [[ $ccs =~ fasta\$ ]]; then
- OUT_EXT="fasta"
- elif [[ $ccs =~ fasta.gz\$ ]]; then
- OUT_EXT="fasta.gz"
- elif [[ $ccs =~ fastq\$ ]]; then
- OUT_EXT="fastq"
- elif [[ $ccs =~ fastq.gz\$ ]]; then
- OUT_EXT="fastq.gz"
- fi
-
- lima \\
- $ccs \\
- $primers \\
- $prefix.\$OUT_EXT \\
- -j $task.cpus \\
- $args
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- lima: \$( lima --version | head -n1 | sed 's/lima //g' | sed 's/ (.\\+//g' )
- END_VERSIONS
- """
-
- stub:
- """
- touch dummy.counts
- touch dummy.report
- touch dummy.summary
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- lima: \$( lima --version | head -n1 | sed 's/lima //g' | sed 's/ (.\\+//g' )
- END_VERSIONS
- """
-}
diff --git a/modules/nf-core/lima/meta.yml b/modules/nf-core/lima/meta.yml
deleted file mode 100644
index f22973f0..00000000
--- a/modules/nf-core/lima/meta.yml
+++ /dev/null
@@ -1,174 +0,0 @@
-name: lima
-description: lima - The PacBio Barcode Demultiplexer and Primer Remover
-keywords:
- - isoseq
- - ccs
- - primer
- - pacbio
- - barcode
-tools:
- - lima:
- description: lima - The PacBio Barcode Demultiplexer and Primer Remover
- homepage: https://github.com/PacificBiosciences/pbbioconda
- documentation: https://lima.how/
- tool_dev_url: https://github.com/pacificbiosciences/barcoding/
- licence: ["BSD-3-Clause-Clear"]
- identifier: ""
-input:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - ccs:
- type: file
- description: A BAM or fasta or fasta.gz or fastq or fastq.gz file of subreads
- or ccs
- pattern: "*.{bam,fasta,fasta.gz,fastq,fastq.gz}"
- - - primers:
- type: file
- description: Fasta file, sequences of primers
- pattern: "*.fasta"
-output:
- - counts:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.counts":
- type: file
- description: A tabulated file of describing pairs of primers
- pattern: "*.counts"
- - report:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.report":
- type: file
- description: A tab-separated file about each ZMW, unfiltered
- pattern: "*.report"
- - summary:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.summary":
- type: file
- description: This file shows how many ZMWs have been filtered, how ZMWs many
- are same/different, and how many reads have been filtered.
- pattern: "*.summary"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
- - bam:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.bam":
- type: file
- description: A bam file of ccs purged of primers
- pattern: "*.bam"
- - pbi:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.bam.pbi":
- type: file
- description: Pacbio index file of ccs purged of primers
- pattern: "*.bam"
- - fasta:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.{fa, fasta}":
- type: file
- description: A fasta file of ccs purged of primers.
- pattern: "*.fa"
- - fastagz:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.{fa.gz, fasta.gz}":
- type: file
- description: A fasta.gz file of ccs purged of primers.
- pattern: "*.fasta.gz"
- - fastq:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.fastq":
- type: file
- description: A fastq file of ccs purged of primers.
- pattern: "*.fastq"
- - fastqgz:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.fastq.gz":
- type: file
- description: A fastq.gz file of ccs purged of primers.
- pattern: "*.fastq.gz"
- - xml:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.xml":
- type: file
- description: An XML file representing a set of a particular sequence data type
- such as subreads, references or aligned subreads.
- pattern: "*.xml"
- - json:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.json":
- type: file
- description: A metadata json file
- pattern: "*.json"
- - clips:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.clips":
- type: file
- description: A fasta file of clipped primers
- pattern: "*.clips"
- - guess:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test' ]
- - "*.guess":
- type: file
- description: A second tabulated file of describing pairs of primers (no doc
- available)
- pattern: "*.guess"
-authors:
- - "@sguizard"
-maintainers:
- - "@sguizard"
diff --git a/modules/nf-core/lima/tests/main.nf.test b/modules/nf-core/lima/tests/main.nf.test
deleted file mode 100644
index f5cb6b86..00000000
--- a/modules/nf-core/lima/tests/main.nf.test
+++ /dev/null
@@ -1,263 +0,0 @@
-nextflow_process {
-
- name "Test Process LIMA"
- script "../main.nf"
- config "./nextflow.config"
- process "LIMA"
-
- tag "modules"
- tag "modules_nfcore"
- tag "lima"
-
- test("LIMA - Primer Removal - Input => bam") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/bam/alz.ccs.bam', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.counts).match("counts") },
- { assert snapshot(process.out.report).match("report") },
- { assert snapshot(process.out.summary).match("summary") },
- { assert snapshot(process.out.versions).match("versions") },
- { assert snapshot(process.out.bam).match("bam") },
- { assert snapshot(process.out.pbi).match("pbi") },
- { assert snapshot(process.out.fasta).match("fasta") },
- { assert snapshot(process.out.fastagz).match("fastagz") },
- { assert snapshot(process.out.fastq).match("fastq") },
- { assert snapshot(process.out.fastqgz).match("fastqgz") },
- { assert snapshot(process.out.clips).match("clips") },
- { assert snapshot(process.out.guess).match("guess") }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fa") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/alz.ccs.fasta', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fa.gz") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/alz.ccs.fasta.gz', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fq") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fq.gz") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq.gz', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => bam - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/bam/alz.ccs.bam', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fa - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/alz.ccs.fasta', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fa.gz - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/alz.ccs.fasta.gz', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fq - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
- test("LIMA - Primer Removal - Input => fq.gz - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [
- [ id:'test' ], // meta map
- file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fastq/alz.ccs.fastq.gz', checkIfExists: true),
- ]
- input[1] = [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/pacbio/fasta/primers.fasta', checkIfExists: true) ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
-}
\ No newline at end of file
diff --git a/modules/nf-core/lima/tests/main.nf.test.snap b/modules/nf-core/lima/tests/main.nf.test.snap
deleted file mode 100644
index 334b6936..00000000
--- a/modules/nf-core/lima/tests/main.nf.test.snap
+++ /dev/null
@@ -1,1486 +0,0 @@
-{
- "summary": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,bcbcaaaca418bdeb91141c81715ca420"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:00.704932"
- },
- "fastqgz": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:01.98256"
- },
- "counts": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,842c6a23ca2de504ced4538ad5111da1"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:00.491188"
- },
- "clips": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,fa03bc75bd78b2648a139fd67c69208f"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:02.19417"
- },
- "LIMA - Primer Removal - Input => fq.gz - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
-
- ],
- "13": [
-
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
-
- ],
- "5": [
-
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
-
- ],
- "clips": [
-
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
-
- ],
- "json": [
-
- ],
- "pbi": [
-
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:17:04.481318"
- },
- "LIMA - Primer Removal - Input => fq.gz": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,767b687e6eda7b24cd0e577f527eb2f0"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,ad2a9b1eeb4cda4a1f69ef4b7520b5fd"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,5c16ef8122f6f1798acc30eb8a30828c"
- ]
- ],
- "13": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,31b988aab6bda84867e704b9edd8a763"
- ]
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,e91d3c386aaf4effa63f33ee2eb7da2a"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "5": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.fastq.gz:md5,ef395f689c5566f501e300bb83d7a5f2"
- ]
- ],
- "bam": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "clips": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,5c16ef8122f6f1798acc30eb8a30828c"
- ]
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,767b687e6eda7b24cd0e577f527eb2f0"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.fastq.gz:md5,ef395f689c5566f501e300bb83d7a5f2"
- ]
- ],
- "guess": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,31b988aab6bda84867e704b9edd8a763"
- ]
- ],
- "json": [
-
- ],
- "pbi": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,ad2a9b1eeb4cda4a1f69ef4b7520b5fd"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,e91d3c386aaf4effa63f33ee2eb7da2a"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:41.110353"
- },
- "LIMA - Primer Removal - Input => fq": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,767b687e6eda7b24cd0e577f527eb2f0"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,ad2a9b1eeb4cda4a1f69ef4b7520b5fd"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,5c16ef8122f6f1798acc30eb8a30828c"
- ]
- ],
- "13": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,31b988aab6bda84867e704b9edd8a763"
- ]
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,e91d3c386aaf4effa63f33ee2eb7da2a"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "5": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.fastq:md5,ef395f689c5566f501e300bb83d7a5f2"
- ]
- ],
- "9": [
-
- ],
- "bam": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "clips": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,5c16ef8122f6f1798acc30eb8a30828c"
- ]
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,767b687e6eda7b24cd0e577f527eb2f0"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.fastq:md5,ef395f689c5566f501e300bb83d7a5f2"
- ]
- ],
- "fastqgz": [
-
- ],
- "guess": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,31b988aab6bda84867e704b9edd8a763"
- ]
- ],
- "json": [
-
- ],
- "pbi": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,ad2a9b1eeb4cda4a1f69ef4b7520b5fd"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,e91d3c386aaf4effa63f33ee2eb7da2a"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:31.41132"
- },
- "LIMA - Primer Removal - Input => fa.gz - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
-
- ],
- "13": [
-
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
-
- ],
- "5": [
-
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
-
- ],
- "clips": [
-
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
-
- ],
- "json": [
-
- ],
- "pbi": [
-
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:55.396572"
- },
- "fasta": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:01.262691"
- },
- "LIMA - Primer Removal - Input => fq - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
-
- ],
- "13": [
-
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
-
- ],
- "5": [
-
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
-
- ],
- "clips": [
-
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
-
- ],
- "json": [
-
- ],
- "pbi": [
-
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:59.983156"
- },
- "bam": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,59b04f200c309b0a60a3f182d22f6910"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:01.243385"
- },
- "LIMA - Primer Removal - Input => bam - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
-
- ],
- "13": [
-
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
-
- ],
- "5": [
-
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
-
- ],
- "clips": [
-
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
-
- ],
- "json": [
-
- ],
- "pbi": [
-
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:46.316856"
- },
- "LIMA - Primer Removal - Input => fa - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
-
- ],
- "13": [
-
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
-
- ],
- "5": [
-
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
-
- ],
- "clips": [
-
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "dummy.counts:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
-
- ],
- "json": [
-
- ],
- "pbi": [
-
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "dummy.report:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "dummy.summary:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:50.996309"
- },
- "fastagz": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:01.493258"
- },
- "versions": {
- "content": [
- [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:01.136138"
- },
- "guess": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,d3675af3ca8a908ee9e3c231668392d3"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:02.396472"
- },
- "pbi": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,851cf26eb54e4399cba5241db969dc0c"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:01.343034"
- },
- "report": {
- "content": [
- [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,dc073985322ae0a003ccc7e0fa4db5e6"
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:00.626772"
- },
- "LIMA - Primer Removal - Input => fa": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,a4ceaa408be334eaa711577e95f8730e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,bd4a8bde17471563cf91aab4c787911d"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,1012bc8874a14836f291bac48e8482a4"
- ]
- ],
- "13": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,651e5f2b438b8ceadb3e06a2177e1818"
- ]
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,03be2311ba4afb878d8e547ab38c11eb"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "5": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "clips": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,1012bc8874a14836f291bac48e8482a4"
- ]
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,a4ceaa408be334eaa711577e95f8730e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,651e5f2b438b8ceadb3e06a2177e1818"
- ]
- ],
- "json": [
-
- ],
- "pbi": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,bd4a8bde17471563cf91aab4c787911d"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,03be2311ba4afb878d8e547ab38c11eb"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:11.510737"
- },
- "fastq": {
- "content": [
- [
-
- ]
- ],
- "meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-01-17T11:35:01.752773"
- },
- "LIMA - Primer Removal - Input => fa.gz": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,a4ceaa408be334eaa711577e95f8730e"
- ]
- ],
- "1": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,bd4a8bde17471563cf91aab4c787911d"
- ]
- ],
- "10": [
-
- ],
- "11": [
-
- ],
- "12": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,1012bc8874a14836f291bac48e8482a4"
- ]
- ],
- "13": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,651e5f2b438b8ceadb3e06a2177e1818"
- ]
- ],
- "2": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,03be2311ba4afb878d8e547ab38c11eb"
- ]
- ],
- "3": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "4": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "5": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "6": [
-
- ],
- "7": [
-
- ],
- "8": [
-
- ],
- "9": [
-
- ],
- "bam": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam:md5,c5d3d376ca7ffc32ef5cbabcc9850804"
- ]
- ],
- "clips": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.clips:md5,1012bc8874a14836f291bac48e8482a4"
- ]
- ],
- "counts": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.counts:md5,a4ceaa408be334eaa711577e95f8730e"
- ]
- ],
- "fasta": [
-
- ],
- "fastagz": [
-
- ],
- "fastq": [
-
- ],
- "fastqgz": [
-
- ],
- "guess": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.guess:md5,651e5f2b438b8ceadb3e06a2177e1818"
- ]
- ],
- "json": [
-
- ],
- "pbi": [
- [
- {
- "id": "test"
- },
- "test.fl.NEB_5p--NEB_Clontech_3p.bam.pbi:md5,d1d6a2f961b9fb3d29837555706c59eb"
- ]
- ],
- "report": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.report:md5,bd4a8bde17471563cf91aab4c787911d"
- ]
- ],
- "summary": [
- [
- {
- "id": "test"
- },
- "test.fl.lima.summary:md5,03be2311ba4afb878d8e547ab38c11eb"
- ]
- ],
- "versions": [
- "versions.yml:md5,3253df3f697bdcd8cceee60e0b4ebdaf"
- ],
- "xml": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-13T13:16:21.321812"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/lima/tests/nextflow.config b/modules/nf-core/lima/tests/nextflow.config
deleted file mode 100644
index ac259b70..00000000
--- a/modules/nf-core/lima/tests/nextflow.config
+++ /dev/null
@@ -1,7 +0,0 @@
-process {
-
- publishDir = { "${params.outdir}/${task.process.tokenize(':')[-1].tokenize('_')[0].toLowerCase()}" }
- ext.args = '--isoseq --peek-guess'
- ext.prefix = { "${meta.id}.fl" }
-
-}
diff --git a/modules/nf-core/links/links.diff b/modules/nf-core/links/links.diff
new file mode 100644
index 00000000..1386c88a
--- /dev/null
+++ b/modules/nf-core/links/links.diff
@@ -0,0 +1,21 @@
+Changes in component 'nf-core/links'
+'modules/nf-core/links/environment.yml' is unchanged
+'modules/nf-core/links/meta.yml' is unchanged
+Changes in 'links/main.nf':
+--- modules/nf-core/links/main.nf
++++ modules/nf-core/links/main.nf
+@@ -30,7 +30,8 @@
+ script:
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ // Currently LINKS does not support more than 4 threads
+- def nthreads = "${task.cpus}" < 4 ? "${task.cpus}" : 4
++ def ncpu = "${task.cpus}".toInteger()
++ def nthreads = ncpu < 4 ? ncpu : 4
+ def args = task.ext.args ?: ""
+ """
+ if [[ ${assembly} == *.gz ]];
+
+'modules/nf-core/links/tests/nextflow.config' is unchanged
+'modules/nf-core/links/tests/main.nf.test' is unchanged
+'modules/nf-core/links/tests/main.nf.test.snap' is unchanged
+************************************************************
diff --git a/modules/nf-core/links/main.nf b/modules/nf-core/links/main.nf
index c55bc661..0034f41c 100644
--- a/modules/nf-core/links/main.nf
+++ b/modules/nf-core/links/main.nf
@@ -22,7 +22,7 @@ process LINKS {
tuple val(meta), path("*.assembly_correspondence.tsv"), emit: assembly_correspondence
tuple val(meta), path("*.simplepair_checkpoint.tsv"), emit: simplepair_checkpoint, optional: true
tuple val(meta), path("*.tigpair_checkpoint.tsv"), emit: tigpair_checkpoint
- path "versions.yml", emit: versions
+ tuple val("${task.process}"), val('liftoff'), eval("echo \$(LINKS | grep -o 'LINKS v.*' | sed 's/LINKS v//')"), emit: versions_links, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -30,7 +30,8 @@ process LINKS {
script:
def prefix = task.ext.prefix ?: "${meta.id}"
// Currently LINKS does not support more than 4 threads
- def nthreads = "${task.cpus}" < 4 ? "${task.cpus}" : 4
+ def ncpu = "${task.cpus}".toInteger()
+ def nthreads = ncpu < 4 ? ncpu : 4
def args = task.ext.args ?: ""
"""
if [[ ${assembly} == *.gz ]];
@@ -43,7 +44,7 @@ process LINKS {
for read_file in ${reads};
do
if [[ \$read_file == *.gz ]];
- then
+ then
gzip -dc \$read_file > \$(basename \$read_file .gz)
echo \$(basename \$read_file .gz) >> readfile.fof
else
diff --git a/modules/nf-core/links/meta.yml b/modules/nf-core/links/meta.yml
index 852cf2bb..9cdcde4f 100644
--- a/modules/nf-core/links/meta.yml
+++ b/modules/nf-core/links/meta.yml
@@ -1,10 +1,9 @@
----
name: "links"
description: |
LINKS is a genomics application for scaffolding genome assemblies with long reads,
- such as those produced by Oxford Nanopore Technologies Ltd.
- It can be used to scaffold high-quality draft genome assemblies with any long sequences
- (eg. ONT reads, PacBio reads, other draft genomes, etc).
+ such as those produced by Oxford Nanopore Technologies Ltd.
+ It can be used to scaffold high-quality draft genome assemblies with any long sequences
+ (eg. ONT reads, PacBio reads, other draft genomes, etc).
It is also used to scaffold contig pairs linked by ARCS/ARKS.
This module is for LINKS >=2.0.0 and does not support MPET input.
keywords:
@@ -18,9 +17,9 @@ tools:
documentation: "https://github.com/bcgsc/LINKS"
tool_dev_url: "https://github.com/bcgsc/LINKS"
doi: "10.1186/s13742-015-0076-3"
- licence: ["GPL v3"]
+ licence:
+ - "GPL v3"
identifier: ""
-
input:
- - meta:
type: map
@@ -31,6 +30,7 @@ input:
type: file
description: (Multi-)fasta file containing the draft assembly
pattern: "*.{fa,fasta,fa.gz,fasta.gz}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -38,12 +38,14 @@ input:
e.g. `[ id:'sample1' ]`
- reads:
type: file
- description: fastq file(s) containing the long reads to be used for scaffolding
+ description: fastq file(s) containing the long reads to be used for
+ scaffolding
pattern: "*.{fq,fastq,fq.gz,fastq.gz}"
-
+ ontologies:
+ - edam: http://edamontology.org/format_1930
output:
- - log:
- - meta:
+ log:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -52,8 +54,9 @@ output:
type: file
description: text file; Logs execution time / errors / pairing stats.
pattern: "*.log"
- - pairing_distribution:
- - meta:
+ ontologies: []
+ pairing_distribution:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -66,8 +69,10 @@ output:
within the same contig. 2nd column is the number of pairs at
that distance.
pattern: "*.pairing_distribution.csv"
- - pairing_issues:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3752
+ pairing_issues:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -78,8 +83,9 @@ output:
text file; Lists all pairing issues encountered between contig
pairs and illogical/out-of-bounds pairing.
pattern: "*.pairing_issues"
- - scaffolds_csv:
- - meta:
+ ontologies: []
+ scaffolds_csv:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -88,8 +94,9 @@ output:
type: file
description: comma-separated file; containing the new scaffold(s)
pattern: "*.scaffolds"
- - scaffolds_fasta:
- - meta:
+ ontologies: []
+ scaffolds_fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -98,8 +105,9 @@ output:
type: file
description: fasta file of the new scaffold sequence
pattern: "*.scaffolds.fa"
- - bloom:
- - meta:
+ ontologies: []
+ bloom:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -110,8 +118,9 @@ output:
Bloom filter created by shredding the -f input
into k-mers of size -k
pattern: "*.bloom"
- - scaffolds_graph:
- - meta:
+ ontologies: []
+ scaffolds_graph:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -119,11 +128,12 @@ output:
- "*.gv":
type: file
description: |
- scaffold graph (for visualizing merges), can be rendered
+ scaffold graph (for visualizing merges), can be rendered
in neato, graphviz, etc
pattern: "*.gv"
- - assembly_correspondence:
- - meta:
+ ontologies: []
+ assembly_correspondence:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -135,18 +145,23 @@ output:
contig ID, original_name, #linking kmer pairs,
links ratio, gap or overlap
pattern: "*.assembly_correspondence.tsv"
- - simplepair_checkpoint:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3475
+ simplepair_checkpoint:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. `[ id:'sample1']`
- "*.simplepair_checkpoint.tsv":
type: file
- description: checkpoint file, contains info to rebuild datastructure for .gv graph
+ description: checkpoint file, contains info to rebuild datastructure for
+ .gv graph
pattern: "*.simplepair_checkpoint.tsv"
- - tigpair_checkpoint:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3475
+ tigpair_checkpoint:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -154,21 +169,38 @@ output:
- "*.tigpair_checkpoint.tsv":
type: file
description: |
- if -b BASNAME.tigpair_checkpoint.tsv is present,
+ if -b BASNAME.tigpair_checkpoint.tsv is present,
LINKS will skip the kmer pair extraction and contig pairing stages.
Delete this file to force LINKS to start at the beginning.
- This file can be used to:
- 1) quickly test parameters (-l min. links / -a min. links ratio),
+ This file can be used to:
+ 1) quickly test parameters (-l min. links / -a min. links ratio),
2) quickly recover from crash,
3) explore very large kmer spaces,
4) scaffold with output of ARCS
pattern: "*.tigpair_checkpoint.tsv"
- - versions:
- - "versions.yml":
- type: file
- description: File containing software versions
- pattern: "versions.yml"
-
+ ontologies:
+ - edam: http://edamontology.org/format_3475
+ versions_links:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - liftoff:
+ type: string
+ description: The name of the tool
+ - echo \$(LINKS | grep -o 'LINKS v.*' | sed 's/LINKS v//'):
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - liftoff:
+ type: string
+ description: The name of the tool
+ - echo \$(LINKS | grep -o 'LINKS v.*' | sed 's/LINKS v//'):
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@nschan"
maintainers:
diff --git a/modules/nf-core/links/tests/main.nf.test b/modules/nf-core/links/tests/main.nf.test
index bbffb1dd..b10ecd46 100644
--- a/modules/nf-core/links/tests/main.nf.test
+++ b/modules/nf-core/links/tests/main.nf.test
@@ -21,7 +21,7 @@ nextflow_process {
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fasta/contigs.fasta', checkIfExists: true),
]
input[1] = [
- [ id:'test'],
+ [ id:'test'],
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
]
"""
@@ -33,14 +33,14 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
file(process.out.log[0][1]).name,
- process.out.pairing_issues,
+ path(process.out.pairing_issues[0][1]).text == "",
process.out.scaffolds_csv,
process.out.scaffolds_fasta,
process.out.bloom,
file(process.out.scaffolds_graph[0][1]).name,
process.out.assembly_correspondence,
- process.out.tigpair_checkpoint,
- process.out.versions
+ file(process.out.tigpair_checkpoint[0][1]).name,
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match()
}
)
@@ -62,7 +62,7 @@ nextflow_process {
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fasta/scaffolds.fasta', checkIfExists: true),
]
input[1] = [
- [ id:'test'],
+ [ id:'test'],
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fasta/contigs.fasta', checkIfExists: true),
]
"""
@@ -74,14 +74,14 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
file(process.out.log[0][1]).name,
- process.out.pairing_issues,
+ file(process.out.pairing_issues[0][1]).text=="",
process.out.scaffolds_csv,
process.out.scaffolds_fasta,
process.out.bloom,
file(process.out.scaffolds_graph[0][1]).name,
process.out.assembly_correspondence,
- process.out.tigpair_checkpoint,
- process.out.versions
+ file(process.out.tigpair_checkpoint[0][1]).text=="",
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match()
}
)
@@ -104,7 +104,7 @@ nextflow_process {
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
]
input[1] = [
- [ id:'test'],
+ [ id:'test'],
file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fasta/contigs.fasta', checkIfExists: true),
]
"""
diff --git a/modules/nf-core/links/tests/main.nf.test.snap b/modules/nf-core/links/tests/main.nf.test.snap
index 8c19d398..a7870de4 100644
--- a/modules/nf-core/links/tests/main.nf.test.snap
+++ b/modules/nf-core/links/tests/main.nf.test.snap
@@ -2,14 +2,7 @@
"LINKS - sarscov2 test data - scaffolds": {
"content": [
"test.log",
- [
- [
- {
- "id": "test"
- },
- "test.pairing_issues:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
+ true,
[
[
{
@@ -43,23 +36,22 @@
"test.assembly_correspondence.tsv:md5,a65d30663dce705d382df52ab87ca8a4"
]
],
- [
- [
- {
- "id": "test"
- },
- "test.tigpair_checkpoint.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
+ true,
+ {
+ "versions_links": [
+ [
+ "LINKS",
+ "liftoff",
+ "2.0.1"
+ ]
]
- ],
- [
- "versions.yml:md5,f58863e433b849b1ef0dfc19cb57656b"
- ]
+ }
],
+ "timestamp": "2026-02-17T16:35:15.663121765",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-25T14:13:53.050775593"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"LINKS - stub": {
"content": [
@@ -81,7 +73,11 @@
]
],
"10": [
- "versions.yml:md5,f58863e433b849b1ef0dfc19cb57656b"
+ [
+ "LINKS",
+ "liftoff",
+ "2.0.1"
+ ]
],
"2": [
[
@@ -227,28 +223,25 @@
"test.tigpair_checkpoint.tsv:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,f58863e433b849b1ef0dfc19cb57656b"
+ "versions_links": [
+ [
+ "LINKS",
+ "liftoff",
+ "2.0.1"
+ ]
]
}
],
+ "timestamp": "2026-02-16T11:20:02.239712752",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-11T11:49:53.947870525"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"LINKS - sarscov2 test data - contigs": {
"content": [
"test.log",
- [
- [
- {
- "id": "test"
- },
- "test.pairing_issues:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
+ true,
[
[
{
@@ -282,22 +275,21 @@
"test.assembly_correspondence.tsv:md5,b36e951b0a1bb4b1c1ccd50925392e3d"
]
],
- [
- [
- {
- "id": "test"
- },
- "test.tigpair_checkpoint.tsv:md5,168f2075f524a86216118c7230ad65e9"
+ "test.tigpair_checkpoint.tsv",
+ {
+ "versions_links": [
+ [
+ "LINKS",
+ "liftoff",
+ "2.0.1"
+ ]
]
- ],
- [
- "versions.yml:md5,f58863e433b849b1ef0dfc19cb57656b"
- ]
+ }
],
+ "timestamp": "2026-02-17T10:53:57.921992204",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-25T14:07:49.212617595"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/merqury/merqury/main.nf b/modules/nf-core/merqury/merqury/main.nf
index 13e07e88..5d3871a5 100644
--- a/modules/nf-core/merqury/merqury/main.nf
+++ b/modules/nf-core/merqury/merqury/main.nf
@@ -16,19 +16,20 @@ process MERQURY_MERQURY {
tuple val(meta), path("*_only.wig") , emit: assembly_only_kmers_wig
tuple val(meta), path("*.completeness.stats"), emit: stats
tuple val(meta), path("*.dist_only.hist") , emit: dist_hist
- tuple val(meta), path("*.spectra-cn.fl.png") , emit: spectra_cn_fl_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-cn.hist") , emit: spectra_cn_hist, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-cn.ln.png") , emit: spectra_cn_ln_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-cn.st.png") , emit: spectra_cn_st_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-asm.fl.png"), emit: spectra_asm_fl_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-asm.hist") , emit: spectra_asm_hist, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-asm.ln.png"), emit: spectra_asm_ln_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.spectra-asm.st.png"), emit: spectra_asm_st_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("${prefix}.qv") , emit: assembly_qv
- tuple val(meta), path("${prefix}.*.qv") , emit: scaffold_qv, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.hist.ploidy") , emit: read_ploidy, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("*.hapmers.blob.png") , emit: hapmers_blob_png, optional: true
- path "versions.yml" , emit: versions
+ tuple val(meta), path("*.spectra-cn.fl.png") , emit: spectra_cn_fl_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-cn.hist") , emit: spectra_cn_hist, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-cn.ln.png") , emit: spectra_cn_ln_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-cn.st.png") , emit: spectra_cn_st_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-asm.fl.png"), emit: spectra_asm_fl_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-asm.hist") , emit: spectra_asm_hist, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-asm.ln.png"), emit: spectra_asm_ln_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.spectra-asm.st.png"), emit: spectra_asm_st_png, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("${prefix}.qv") , emit: assembly_qv, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("${prefix}.*.qv") , emit: scaffold_qv, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.hist.ploidy") , emit: read_ploidy, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.hapmers.blob.png") , emit: hapmers_blob_png , optional: true
+ // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions.
+ tuple val("${task.process}"), val('merqury'), val('1.3'), emit: versions_merqury, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -36,7 +37,6 @@ process MERQURY_MERQURY {
script:
// def args = task.ext.args ?: ''
prefix = task.ext.prefix ?: "${meta.id}"
- def VERSION = 1.3 // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions.
"""
# Nextflow changes the container --entrypoint to /bin/bash (container default entrypoint: /usr/local/env-execute)
# Check for container variable initialisation script and source it.
@@ -52,11 +52,6 @@ process MERQURY_MERQURY {
$meryl_db \\
$assembly \\
$prefix
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- merqury: $VERSION
- END_VERSIONS
"""
stub:
@@ -78,10 +73,5 @@ process MERQURY_MERQURY {
touch ${prefix}.qv
touch ${prefix}.${prefix}.qv
touch ${prefix}.hist.ploidy
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- merqury: $VERSION
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/merqury/merqury/merqury-merqury.diff b/modules/nf-core/merqury/merqury/merqury-merqury.diff
index a0a65d32..9da9985a 100644
--- a/modules/nf-core/merqury/merqury/merqury-merqury.diff
+++ b/modules/nf-core/merqury/merqury/merqury-merqury.diff
@@ -4,7 +4,7 @@ Changes in component 'nf-core/merqury/merqury'
Changes in 'merqury/merqury/main.nf':
--- modules/nf-core/merqury/merqury/main.nf
+++ modules/nf-core/merqury/merqury/main.nf
-@@ -16,18 +16,18 @@
+@@ -16,17 +16,17 @@
tuple val(meta), path("*_only.wig") , emit: assembly_only_kmers_wig
tuple val(meta), path("*.completeness.stats"), emit: stats
tuple val(meta), path("*.dist_only.hist") , emit: dist_hist
@@ -16,24 +16,23 @@ Changes in 'merqury/merqury/main.nf':
- tuple val(meta), path("*.spectra-asm.hist") , emit: spectra_asm_hist
- tuple val(meta), path("*.spectra-asm.ln.png"), emit: spectra_asm_ln_png
- tuple val(meta), path("*.spectra-asm.st.png"), emit: spectra_asm_st_png
-+ tuple val(meta), path("*.spectra-cn.fl.png") , emit: spectra_cn_fl_png, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-cn.hist") , emit: spectra_cn_hist, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-cn.ln.png") , emit: spectra_cn_ln_png, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-cn.st.png") , emit: spectra_cn_st_png, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-asm.fl.png"), emit: spectra_asm_fl_png, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-asm.hist") , emit: spectra_asm_hist, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-asm.ln.png"), emit: spectra_asm_ln_png, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.spectra-asm.st.png"), emit: spectra_asm_st_png, optional: true // optional to make full_test pass, where this file is not created.
- tuple val(meta), path("${prefix}.qv") , emit: assembly_qv
+- tuple val(meta), path("${prefix}.qv") , emit: assembly_qv
- tuple val(meta), path("${prefix}.*.qv") , emit: scaffold_qv
- tuple val(meta), path("*.hist.ploidy") , emit: read_ploidy
-- tuple val(meta), path("*.hapmers.blob.png") , emit: hapmers_blob_png , optional: true
-+ tuple val(meta), path("${prefix}.*.qv") , emit: scaffold_qv, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.hist.ploidy") , emit: read_ploidy, optional: true // optional to make full_test pass, where this file is not created.
-+ tuple val(meta), path("*.hapmers.blob.png") , emit: hapmers_blob_png, optional: true
- path "versions.yml" , emit: versions
-
- when:
++ tuple val(meta), path("*.spectra-cn.fl.png") , emit: spectra_cn_fl_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-cn.hist") , emit: spectra_cn_hist, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-cn.ln.png") , emit: spectra_cn_ln_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-cn.st.png") , emit: spectra_cn_st_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-asm.fl.png"), emit: spectra_asm_fl_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-asm.hist") , emit: spectra_asm_hist, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-asm.ln.png"), emit: spectra_asm_ln_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.spectra-asm.st.png"), emit: spectra_asm_st_png, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("${prefix}.qv") , emit: assembly_qv, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("${prefix}.*.qv") , emit: scaffold_qv, optional: true // optional to make full_test pass, where this file is not created.
++ tuple val(meta), path("*.hist.ploidy") , emit: read_ploidy, optional: true // optional to make full_test pass, where this file is not created.
+ tuple val(meta), path("*.hapmers.blob.png") , emit: hapmers_blob_png , optional: true
+ // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions.
+ tuple val("${task.process}"), val('merqury'), val('1.3'), emit: versions_merqury, topic: versions
'modules/nf-core/merqury/merqury/tests/main.nf.test' is unchanged
'modules/nf-core/merqury/merqury/tests/main.nf.test.snap' is unchanged
diff --git a/modules/nf-core/merqury/merqury/meta.yml b/modules/nf-core/merqury/merqury/meta.yml
index 7e8d875a..c4ef77c8 100644
--- a/modules/nf-core/merqury/merqury/meta.yml
+++ b/modules/nf-core/merqury/merqury/meta.yml
@@ -9,7 +9,8 @@ tools:
description: "Evaluate genome assemblies with k-mers and more."
tool_dev_url: "https://github.com/marbl/merqury"
doi: "10.1186/s13059-020-02134-9"
- licence: ["PUBLIC DOMAIN"]
+ licence:
+ - "PUBLIC DOMAIN"
identifier: biotools:merqury
input:
- - meta:
@@ -20,12 +21,14 @@ input:
- meryl_db:
type: file
description: "Meryl read database"
+ ontologies: []
- assembly:
type: file
description: FASTA assembly file
+ ontologies: []
output:
- - assembly_only_kmers_bed:
- - meta:
+ assembly_only_kmers_bed:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -35,8 +38,9 @@ output:
description: "The positions of the k-mers found only in an assembly for further
investigation in .bed"
pattern: "*_only.bed"
- - assembly_only_kmers_wig:
- - meta:
+ ontologies: []
+ assembly_only_kmers_wig:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -46,8 +50,9 @@ output:
description: "The positions of the k-mers found only in an assembly for further
investigation in .wig"
pattern: "*_only.wig"
- - stats:
- - meta:
+ ontologies: []
+ stats:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -56,8 +61,9 @@ output:
type: file
description: Assembly statistics file
pattern: "*.completeness.stats"
- - dist_hist:
- - meta:
+ ontologies: []
+ dist_hist:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -66,8 +72,9 @@ output:
type: file
description: Histogram
pattern: "*.dist_only.hist"
- - spectra_cn_fl_png:
- - meta:
+ ontologies: []
+ spectra_cn_fl_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -76,8 +83,9 @@ output:
type: file
description: "Unstacked copy number spectra filled plot in PNG format"
pattern: "*.spectra-cn.fl.png"
- - spectra_cn_hist:
- - meta:
+ ontologies: []
+ spectra_cn_hist:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -86,8 +94,9 @@ output:
type: file
description: "Copy number spectra histogram"
pattern: "*.spectra-cn.hist"
- - spectra_cn_ln_png:
- - meta:
+ ontologies: []
+ spectra_cn_ln_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -96,8 +105,9 @@ output:
type: file
description: "Unstacked copy number spectra line plot in PNG format"
pattern: "*.spectra-cn.ln.png"
- - spectra_cn_st_png:
- - meta:
+ ontologies: []
+ spectra_cn_st_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -106,8 +116,9 @@ output:
type: file
description: "Stacked copy number spectra line plot in PNG format"
pattern: "*.spectra-cn.st.png"
- - spectra_asm_fl_png:
- - meta:
+ ontologies: []
+ spectra_asm_fl_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -116,8 +127,9 @@ output:
type: file
description: "Unstacked assembly spectra filled plot in PNG format"
pattern: "*.spectra-asm.fl.png"
- - spectra_asm_hist:
- - meta:
+ ontologies: []
+ spectra_asm_hist:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -126,8 +138,9 @@ output:
type: file
description: "Assembly spectra histogram"
pattern: "*.spectra-asm.hist"
- - spectra_asm_ln_png:
- - meta:
+ ontologies: []
+ spectra_asm_ln_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -136,8 +149,9 @@ output:
type: file
description: "Unstacked assembly spectra line plot in PNG format"
pattern: "*.spectra-asm.ln.png"
- - spectra_asm_st_png:
- - meta:
+ ontologies: []
+ spectra_asm_st_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -146,8 +160,9 @@ output:
type: file
description: "Stacked assembly spectra line plot in PNG format"
pattern: "*.spectra-asm.st.png"
- - assembly_qv:
- - meta:
+ ontologies: []
+ assembly_qv:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -156,8 +171,9 @@ output:
type: file
description: "Assembly consensus quality estimation"
pattern: "*.qv"
- - scaffold_qv:
- - meta:
+ ontologies: []
+ scaffold_qv:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -166,8 +182,9 @@ output:
type: file
description: "Scaffold consensus quality estimation"
pattern: "*.qv"
- - read_ploidy:
- - meta:
+ ontologies: []
+ read_ploidy:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -176,8 +193,9 @@ output:
type: file
description: "Ploidy estimate from read k-mer database"
pattern: "*.hist.ploidy"
- - hapmers_blob_png:
- - meta:
+ ontologies: []
+ hapmers_blob_png:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -186,11 +204,28 @@ output:
type: file
description: "Hap-mer blob plot"
pattern: "*.hapmers.blob.png"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_merqury:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - merqury:
+ type: string
+ description: The name of the tool
+ - '"1.3"':
+ type: string
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - merqury:
+ type: string
+ description: The name of the tool
+ - '"1.3"':
+ type: string
+ description: The expression to obtain the version of the tool
authors:
- "@mahesh-panchal"
maintainers:
diff --git a/modules/nf-core/merqury/merqury/tests/main.nf.test b/modules/nf-core/merqury/merqury/tests/main.nf.test
index 46a07c02..7d961bb8 100644
--- a/modules/nf-core/merqury/merqury/tests/main.nf.test
+++ b/modules/nf-core/merqury/merqury/tests/main.nf.test
@@ -66,7 +66,7 @@ nextflow_process {
process.out.assembly_qv,
process.out.scaffold_qv,
process.out.read_ploidy,
- process.out.versions,
+ process.out.findAll { key, val -> key.startsWith('versions') },
file(process.out.spectra_cn_fl_png[0][1]).name,
file(process.out.spectra_cn_ln_png[0][1]).name,
file(process.out.spectra_cn_st_png[0][1]).name,
@@ -146,7 +146,7 @@ nextflow_process {
process.out.assembly_qv,
process.out.scaffold_qv,
process.out.read_ploidy,
- process.out.versions,
+ process.out.findAll { key, val -> key.startsWith('versions') },
process.out.spectra_cn_fl_png[0][1] .collect { file(it).name }.join(','),
process.out.spectra_cn_ln_png[0][1] .collect { file(it).name }.join(','),
process.out.spectra_cn_st_png[0][1] .collect { file(it).name }.join(','),
@@ -186,4 +186,4 @@ nextflow_process {
}
-}
\ No newline at end of file
+}
diff --git a/modules/nf-core/merqury/merqury/tests/main.nf.test.snap b/modules/nf-core/merqury/merqury/tests/main.nf.test.snap
index 4081b60f..2c52cd0f 100644
--- a/modules/nf-core/merqury/merqury/tests/main.nf.test.snap
+++ b/modules/nf-core/merqury/merqury/tests/main.nf.test.snap
@@ -69,7 +69,11 @@
],
"16": [
- "versions.yml:md5,825a4c61369638389227eee16dfb08b5"
+ [
+ "MERQURY_MERQURY",
+ "merqury",
+ "1.3"
+ ]
],
"2": [
[
@@ -281,16 +285,20 @@
"test.completeness.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,825a4c61369638389227eee16dfb08b5"
+ "versions_merqury": [
+ [
+ "MERQURY_MERQURY",
+ "merqury",
+ "1.3"
+ ]
]
}
],
+ "timestamp": "2026-02-16T14:11:24.534630119",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-05-22T21:00:35.907142"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo_sapiens-genome": {
"content": [
@@ -375,9 +383,15 @@
"test.unionsum.hist.ploidy:md5,3fe5dc377d8c9562980e1b93d01cac94"
]
],
- [
- "versions.yml:md5,825a4c61369638389227eee16dfb08b5"
- ],
+ {
+ "versions_merqury": [
+ [
+ "MERQURY_MERQURY",
+ "merqury",
+ "1.3"
+ ]
+ ]
+ },
"test.genome.spectra-cn.fl.png",
"test.genome.spectra-cn.ln.png",
"test.genome.spectra-cn.st.png",
@@ -385,11 +399,11 @@
"test.spectra-asm.ln.png",
"test.spectra-asm.st.png"
],
+ "timestamp": "2026-02-16T15:50:35.075502455",
"meta": {
- "nf-test": "0.9.1",
- "nextflow": "24.10.0"
- },
- "timestamp": "2024-11-04T12:42:32.360126893"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"homo_sapiens-genome-trio": {
"content": [
@@ -474,9 +488,15 @@
"test.unionsum.hist.ploidy:md5,3fe5dc377d8c9562980e1b93d01cac94"
]
],
- [
- "versions.yml:md5,825a4c61369638389227eee16dfb08b5"
- ],
+ {
+ "versions_merqury": [
+ [
+ "MERQURY_MERQURY",
+ "merqury",
+ "1.3"
+ ]
+ ]
+ },
"test.genome.spectra-cn.fl.png,test.genome.test.test2_1.spectra-cn.fl.png,test.genome.test.test2_2.spectra-cn.fl.png",
"test.genome.spectra-cn.ln.png,test.genome.test.test2_1.spectra-cn.ln.png,test.genome.test.test2_2.spectra-cn.ln.png",
"test.genome.spectra-cn.st.png,test.genome.test.test2_1.spectra-cn.st.png,test.genome.test.test2_2.spectra-cn.st.png",
@@ -485,10 +505,10 @@
"test.spectra-asm.st.png",
"test.hapmers.blob.png"
],
+ "timestamp": "2026-02-16T15:52:37.264260087",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.2"
- },
- "timestamp": "2024-12-04T20:06:48.980375307"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/meryl/count/environment.yml b/modules/nf-core/meryl/count/environment.yml
index deebca1f..84d58043 100644
--- a/modules/nf-core/meryl/count/environment.yml
+++ b/modules/nf-core/meryl/count/environment.yml
@@ -4,4 +4,4 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::meryl=1.4.1
+ - bioconda::meryl=1.4.1=h4ac6f70_0
diff --git a/modules/nf-core/meryl/count/main.nf b/modules/nf-core/meryl/count/main.nf
index c90079d6..93c4ec0d 100644
--- a/modules/nf-core/meryl/count/main.nf
+++ b/modules/nf-core/meryl/count/main.nf
@@ -4,8 +4,8 @@ process MERYL_COUNT {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/meryl:1.4.1--h4ac6f70_1':
- 'biocontainers/meryl:1.4.1--h4ac6f70_1' }"
+ 'https://depot.galaxyproject.org/singularity/meryl:1.4.1--h4ac6f70_0':
+ 'biocontainers/meryl:1.4.1--h4ac6f70_0' }"
input:
tuple val(meta), path(reads)
@@ -13,7 +13,8 @@ process MERYL_COUNT {
output:
tuple val(meta), path("*.meryl") , emit: meryl_db
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('meryl'), eval("meryl --version |& sed 's/meryl //'"), emit: versions_meryl, topic: versions
+
when:
task.ext.when == null || task.ext.when
@@ -32,11 +33,6 @@ process MERYL_COUNT {
\$READ \\
output ${prefix}.\${READ%.f*}.meryl
done
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- meryl: \$( meryl --version |& sed -n 's/.* \\([a-f0-9]\\{40\\}\\))/\\1/p' )
- END_VERSIONS
"""
stub:
@@ -45,10 +41,5 @@ process MERYL_COUNT {
for READ in ${reads}; do
touch ${prefix}.\${READ%.f*}.meryl
done
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- meryl: \$( meryl --version |& sed -n 's/.* \\([a-f0-9]\\{40\\}\\))/\\1/p' )
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/meryl/count/meta.yml b/modules/nf-core/meryl/count/meta.yml
index a110a610..080eef04 100644
--- a/modules/nf-core/meryl/count/meta.yml
+++ b/modules/nf-core/meryl/count/meta.yml
@@ -10,7 +10,8 @@ tools:
homepage: "https://github.com/marbl/meryl"
documentation: "https://meryl.readthedocs.io/en/latest/quick-start.html"
tool_dev_url: "https://github.com/marbl/meryl"
- licence: ["GPL"]
+ licence:
+ - "GPL"
identifier: biotools:meryl
input:
- - meta:
@@ -23,12 +24,13 @@ input:
description: |
List of input FastQ files of size 1 and 2 for single-end and paired-end data,
respectively.
- - - kvalue:
- type: integer
- description: An integer value of k to use as the k-mer value.
+ ontologies: []
+ - kvalue:
+ type: integer
+ description: An integer value of k to use as the k-mer value.
output:
- - meryl_db:
- - meta:
+ meryl_db:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -37,11 +39,27 @@ output:
type: directory
description: A Meryl k-mer database
pattern: "*.meryl"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ versions_meryl:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - meryl:
+ type: string
+ description: The name of the tool
+ - meryl --version |& sed 's/meryl //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - meryl:
+ type: string
+ description: The name of the tool
+ - meryl --version |& sed 's/meryl //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@mahesh-panchal"
maintainers:
diff --git a/modules/nf-core/meryl/count/tests/main.nf.test.snap b/modules/nf-core/meryl/count/tests/main.nf.test.snap
index 2e94c03b..ccbb599f 100644
--- a/modules/nf-core/meryl/count/tests/main.nf.test.snap
+++ b/modules/nf-core/meryl/count/tests/main.nf.test.snap
@@ -142,7 +142,11 @@
]
],
"1": [
- "versions.yml:md5,f1c1f87947a64d681c3f0678036cafeb"
+ [
+ "MERYL_COUNT",
+ "meryl",
+ "1.4.1"
+ ]
],
"meryl_db": [
[
@@ -283,16 +287,20 @@
]
]
],
- "versions": [
- "versions.yml:md5,f1c1f87947a64d681c3f0678036cafeb"
+ "versions_meryl": [
+ [
+ "MERYL_COUNT",
+ "meryl",
+ "1.4.1"
+ ]
]
}
],
+ "timestamp": "2026-02-17T14:13:53.351513294",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.2"
- },
- "timestamp": "2024-12-04T12:27:45.159763589"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"bacteroides_fragilis - fastq - stub": {
"content": [
@@ -307,7 +315,11 @@
]
],
"1": [
- "versions.yml:md5,f1c1f87947a64d681c3f0678036cafeb"
+ [
+ "MERYL_COUNT",
+ "meryl",
+ "1.4.1"
+ ]
],
"meryl_db": [
[
@@ -318,15 +330,19 @@
"test.test1_1.meryl:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,f1c1f87947a64d681c3f0678036cafeb"
+ "versions_meryl": [
+ [
+ "MERYL_COUNT",
+ "meryl",
+ "1.4.1"
+ ]
]
}
],
+ "timestamp": "2026-02-17T14:14:00.895730474",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.2"
- },
- "timestamp": "2024-12-04T20:07:50.042776716"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/meryl/unionsum/environment.yml b/modules/nf-core/meryl/unionsum/environment.yml
index deebca1f..84d58043 100644
--- a/modules/nf-core/meryl/unionsum/environment.yml
+++ b/modules/nf-core/meryl/unionsum/environment.yml
@@ -4,4 +4,4 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::meryl=1.4.1
+ - bioconda::meryl=1.4.1=h4ac6f70_0
diff --git a/modules/nf-core/meryl/unionsum/main.nf b/modules/nf-core/meryl/unionsum/main.nf
index bc2853b0..8bf3c21b 100644
--- a/modules/nf-core/meryl/unionsum/main.nf
+++ b/modules/nf-core/meryl/unionsum/main.nf
@@ -13,7 +13,7 @@ process MERYL_UNIONSUM {
output:
tuple val(meta), path("*.unionsum.meryl"), emit: meryl_db
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('meryl'), eval("meryl --version |& sed 's/meryl //'"), emit: versions_meryl, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -29,11 +29,6 @@ process MERYL_UNIONSUM {
$args \\
output ${prefix}.unionsum.meryl \\
$meryl_dbs
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- meryl: \$( meryl --version |& sed 's/meryl //' )
- END_VERSIONS
"""
stub:
@@ -41,10 +36,5 @@ process MERYL_UNIONSUM {
def prefix = task.ext.prefix ?: "${meta.id}"
"""
touch ${prefix}.unionsum.meryl
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- meryl: \$( meryl --version |& sed 's/meryl //' )
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/meryl/unionsum/meta.yml b/modules/nf-core/meryl/unionsum/meta.yml
index e9e13051..add02adf 100644
--- a/modules/nf-core/meryl/unionsum/meta.yml
+++ b/modules/nf-core/meryl/unionsum/meta.yml
@@ -10,7 +10,8 @@ tools:
homepage: "https://github.com/marbl/meryl"
documentation: "https://meryl.readthedocs.io/en/latest/quick-start.html"
tool_dev_url: "https://github.com/marbl/meryl"
- licence: ["GPL"]
+ licence:
+ - "GPL"
identifier: biotools:meryl
input:
- - meta:
@@ -21,25 +22,42 @@ input:
- meryl_dbs:
type: directory
description: Meryl k-mer databases
- - - kvalue:
- type: integer
- description: An integer value of k to use as the k-mer value.
+ - kvalue:
+ type: integer
+ description: An integer value of k to use as the k-mer value.
output:
- - meryl_db:
- - meta:
+ meryl_db:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*.unionsum.meryl":
type: directory
- description: A Meryl k-mer database that is the union sum of the input databases
+ description: A Meryl k-mer database that is the union sum of the input
+ databases
pattern: "*.unionsum.meryl"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ versions_meryl:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - meryl:
+ type: string
+ description: The name of the tool
+ - meryl --version |& sed 's/meryl //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - meryl:
+ type: string
+ description: The name of the tool
+ - meryl --version |& sed 's/meryl //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@mahesh-panchal"
maintainers:
diff --git a/modules/nf-core/meryl/unionsum/tests/main.nf.test.snap b/modules/nf-core/meryl/unionsum/tests/main.nf.test.snap
index fd29eb18..923bac5a 100644
--- a/modules/nf-core/meryl/unionsum/tests/main.nf.test.snap
+++ b/modules/nf-core/meryl/unionsum/tests/main.nf.test.snap
@@ -12,7 +12,11 @@
]
],
"1": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
],
"meryl_db": [
[
@@ -23,16 +27,20 @@
"test.unionsum.meryl:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ "versions_meryl": [
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
]
}
],
+ "timestamp": "2026-02-17T14:05:04.447542381",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-05-22T12:40:21.306142"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"sarscov2 - fastq - single_end": {
"content": [
@@ -177,7 +185,11 @@
]
],
"1": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
],
"meryl_db": [
[
@@ -318,16 +330,20 @@
]
]
],
- "versions": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ "versions_meryl": [
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
]
}
],
+ "timestamp": "2026-02-17T14:04:44.447203629",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "23.10.1"
- },
- "timestamp": "2024-03-27T10:19:25.091170112"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"sarscov2 - fastq - paired_end": {
"content": [
@@ -472,7 +488,11 @@
]
],
"1": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
],
"meryl_db": [
[
@@ -613,15 +633,19 @@
]
]
],
- "versions": [
- "versions.yml:md5,c97980ac5ebd37a77768c105861ad719"
+ "versions_meryl": [
+ [
+ "MERYL_UNIONSUM",
+ "meryl",
+ "1.4.1"
+ ]
]
}
],
+ "timestamp": "2026-02-17T14:04:55.83723977",
"meta": {
- "nf-test": "0.9.1",
- "nextflow": "24.10.0"
- },
- "timestamp": "2024-11-04T12:45:34.142906416"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/minimap2/align/main.nf b/modules/nf-core/minimap2/align/main.nf
index 50e3ecf9..b5748313 100644
--- a/modules/nf-core/minimap2/align/main.nf
+++ b/modules/nf-core/minimap2/align/main.nf
@@ -19,7 +19,7 @@ process MINIMAP2_ALIGN {
tuple val(meta), path("*.paf") , optional: true, emit: paf
tuple val(meta), path("*.bam") , optional: true, emit: bam
tuple val(meta), path("*.bam.${bam_index_extension}"), optional: true, emit: index
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val("minimap2"), eval("minimap2 --version"), topic: versions, emit: versions_minimap2
when:
task.ext.when == null || task.ext.when
@@ -37,25 +37,17 @@ process MINIMAP2_ALIGN {
def bam_input = "${reads.extension}".matches('sam|bam|cram')
def samtools_reset_fastq = bam_input ? "samtools reset --threads ${task.cpus-1} $args3 $reads | samtools fastq --threads ${task.cpus-1} $args4 |" : ''
def query = bam_input ? "-" : reads
- def target = reference ?: (bam_input ? error("BAM input requires reference") : reads)
-
+ def target = reference ?: (bam_input ? error("Error: minimap2/align BAM input mode requires reference") : reads)
"""
$samtools_reset_fastq \\
minimap2 \\
- $args \\
- -t $task.cpus \\
- $target \\
- $query \\
- $cigar_paf \\
- $set_cigar_bam \\
- $bam_output
-
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- minimap2: \$(minimap2 --version 2>&1)
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
+ ${args} \\
+ -t ${task.cpus} \\
+ ${target} \\
+ ${query} \\
+ ${cigar_paf} \\
+ ${set_cigar_bam} \\
+ ${bam_output}
"""
stub:
@@ -63,15 +55,11 @@ process MINIMAP2_ALIGN {
def output_file = bam_format ? "${prefix}.bam" : "${prefix}.paf"
def bam_index = bam_index_extension ? "touch ${prefix}.bam.${bam_index_extension}" : ""
def bam_input = "${reads.extension}".matches('sam|bam|cram')
- def target = reference ?: (bam_input ? error("BAM input requires reference") : reads)
-
+ if(bam_input && !reference) {
+ error("Error: minimap2/align BAM input mode requires reference!")
+ }
"""
touch $output_file
${bam_index}
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- minimap2: \$(minimap2 --version 2>&1)
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/minimap2/align/meta.yml b/modules/nf-core/minimap2/align/meta.yml
index a4cfc891..40bb20ad 100644
--- a/modules/nf-core/minimap2/align/meta.yml
+++ b/modules/nf-core/minimap2/align/meta.yml
@@ -26,6 +26,7 @@ input:
description: |
List of input FASTA or FASTQ files of size 1 and 2 for single-end
and paired-end data, respectively.
+ ontologies: []
- - meta2:
type: map
description: |
@@ -35,23 +36,24 @@ input:
type: file
description: |
Reference database in FASTA format.
- - - bam_format:
- type: boolean
- description: Specify that output should be in BAM format
- - - bam_index_extension:
- type: string
- description: BAM alignment index extension (e.g. "bai")
- - - cigar_paf_format:
- type: boolean
- description: Specify that output CIGAR should be in PAF format
- - - cigar_bam:
- type: boolean
- description: |
- Write CIGAR with >65535 ops at the CG tag. This is recommended when
- doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations)
+ ontologies: []
+ - bam_format:
+ type: boolean
+ description: Specify that output should be in BAM format
+ - bam_index_extension:
+ type: string
+ description: BAM alignment index extension (e.g. "bai")
+ - cigar_paf_format:
+ type: boolean
+ description: Specify that output CIGAR should be in PAF format
+ - cigar_bam:
+ type: boolean
+ description: |
+ Write CIGAR with >65535 ops at the CG tag. This is recommended when
+ doing XYZ (https://github.com/lh3/minimap2#working-with-65535-cigar-operations)
output:
- - paf:
- - meta:
+ paf:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -60,8 +62,9 @@ output:
type: file
description: Alignment in PAF format
pattern: "*.paf"
- - bam:
- - meta:
+ ontologies: []
+ bam:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -70,8 +73,9 @@ output:
type: file
description: Alignment in BAM format
pattern: "*.bam"
- - index:
- - meta:
+ ontologies: []
+ index:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -80,11 +84,28 @@ output:
type: file
description: BAM alignment index
pattern: "*.bam.*"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_minimap2:
+ - - ${task.process}:
+ type: string
+ description: The process name
+ - minimap2:
+ type: string
+ description: The tool name
+ - minimap2 --version:
+ type: eval
+ description: The tool version
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process name
+ - minimap2:
+ type: string
+ description: The tool name
+ - minimap2 --version:
+ type: eval
+ description: The tool version
authors:
- "@heuermh"
- "@sofstam"
diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test b/modules/nf-core/minimap2/align/tests/main.nf.test
index 4072c171..34597d6f 100644
--- a/modules/nf-core/minimap2/align/tests/main.nf.test
+++ b/modules/nf-core/minimap2/align/tests/main.nf.test
@@ -36,7 +36,7 @@ nextflow_process {
{ assert snapshot(
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -71,7 +71,7 @@ nextflow_process {
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
file(process.out.index[0][1]).name,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -108,7 +108,7 @@ nextflow_process {
{ assert snapshot(
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -142,7 +142,7 @@ nextflow_process {
{ assert snapshot(
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -176,7 +176,7 @@ nextflow_process {
{ assert snapshot(
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -211,7 +211,7 @@ nextflow_process {
bam(process.out.bam[0][1]).getHeader(),
bam(process.out.bam[0][1]).getReadsMD5(),
file(process.out.index[0][1]).name,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions_") }
).match() }
)
}
@@ -438,4 +438,4 @@ nextflow_process {
}
-}
\ No newline at end of file
+}
diff --git a/modules/nf-core/minimap2/align/tests/main.nf.test.snap b/modules/nf-core/minimap2/align/tests/main.nf.test.snap
index 89f20336..93e0eb3b 100644
--- a/modules/nf-core/minimap2/align/tests/main.nf.test.snap
+++ b/modules/nf-core/minimap2/align/tests/main.nf.test.snap
@@ -9,15 +9,21 @@
],
"5d426b9a5f5b2c54f1d7f1e4c238ae94",
"test.bam.bai",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:23.829797899"
+ "timestamp": "2026-01-22T15:02:10.851485367"
},
"sarscov2 - bam, fasta, true, 'bai', false, false - stub": {
"content": [
@@ -44,7 +50,11 @@
]
],
"3": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
],
"bam": [
[
@@ -67,16 +77,20 @@
"paf": [
],
- "versions": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:54.665655242"
+ "timestamp": "2026-01-22T15:02:56.708796666"
},
"sarscov2 - fastq, fasta, true, 'bai', false, false - stub": {
"content": [
@@ -103,7 +117,11 @@
]
],
"3": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
],
"bam": [
[
@@ -126,16 +144,20 @@
"paf": [
],
- "versions": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:38.492212433"
+ "timestamp": "2026-01-22T15:02:32.614463827"
},
"sarscov2 - fastq, fasta, false, [], false, false - stub": {
"content": [
@@ -156,7 +178,11 @@
],
"3": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
],
"bam": [
@@ -173,16 +199,20 @@
"test.paf:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:43.879647142"
+ "timestamp": "2026-01-22T15:02:40.02163098"
},
"sarscov2 - fastq, fasta, true, [], false, false - stub": {
"content": [
@@ -203,7 +233,11 @@
],
"3": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
],
"bam": [
[
@@ -220,16 +254,20 @@
"paf": [
],
- "versions": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:33.262333471"
+ "timestamp": "2026-01-22T15:02:25.102539679"
},
"sarscov2 - [fastq1, fastq2], fasta, true, false, false": {
"content": [
@@ -240,15 +278,21 @@
"@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.21\tCL:samtools sort -@ 1 -o test.bam"
],
"1bc392244f228bf52cf0b5a8f6a654c9",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:07.571731983"
+ "timestamp": "2026-01-22T15:01:46.456636022"
},
"sarscov2 - fastq, fasta, true, [], false, false": {
"content": [
@@ -259,15 +303,21 @@
"@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.21\tCL:samtools sort -@ 1 -o test.bam"
],
"f194745c0ccfcb2a9c0aee094a08750",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:47:56.497792473"
+ "timestamp": "2026-01-22T15:01:30.525133177"
},
"sarscov2 - fastq, fasta, true, 'bai', false, false": {
"content": [
@@ -279,15 +329,21 @@
],
"f194745c0ccfcb2a9c0aee094a08750",
"test.bam.bai",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:01.888544427"
+ "timestamp": "2026-01-22T15:01:38.84829029"
},
"sarscov2 - bam, fasta, true, [], false, false": {
"content": [
@@ -298,15 +354,21 @@
"@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.21\tCL:samtools sort -@ 1 -o test.bam"
],
"5d426b9a5f5b2c54f1d7f1e4c238ae94",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:18.376062313"
+ "timestamp": "2026-01-22T15:02:02.351060285"
},
"sarscov2 - bam, fasta, true, [], false, false - stub": {
"content": [
@@ -327,7 +389,11 @@
],
"3": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
],
"bam": [
[
@@ -344,16 +410,20 @@
"paf": [
],
- "versions": [
- "versions.yml:md5,231f31609e2b72661af6a11b7aee3cfe"
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:49.268693724"
+ "timestamp": "2026-01-22T15:02:47.579634041"
},
"sarscov2 - fastq, [], true, false, false": {
"content": [
@@ -463,14 +533,20 @@
"@PG\tID:samtools\tPN:samtools\tPP:minimap2\tVN:1.21\tCL:samtools sort -@ 1 -o test.bam"
],
"16c1c651f8ec67383bcdee3c55aed94f",
- [
- "versions.yml:md5,660fcf8ff66d4dce2045ffa0e325eed8"
- ]
+ {
+ "versions_minimap2": [
+ [
+ "MINIMAP2_ALIGN",
+ "minimap2",
+ "2.29-r1283"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-04-22T14:48:12.942360555"
+ "timestamp": "2026-01-22T15:01:54.090788633"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/porechop/porechop/environment.yml b/modules/nf-core/picard/addorreplacereadgroups/environment.yml
similarity index 68%
rename from modules/nf-core/porechop/porechop/environment.yml
rename to modules/nf-core/picard/addorreplacereadgroups/environment.yml
index 109cf8bd..b4ac4fe0 100644
--- a/modules/nf-core/porechop/porechop/environment.yml
+++ b/modules/nf-core/picard/addorreplacereadgroups/environment.yml
@@ -4,5 +4,5 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::porechop=0.2.4
- - conda-forge::pigz=2.8
+ # renovate: datasource=conda depName=bioconda/picard
+ - bioconda::picard=3.4.0
diff --git a/modules/nf-core/picard/addorreplacereadgroups/main.nf b/modules/nf-core/picard/addorreplacereadgroups/main.nf
new file mode 100644
index 00000000..5ef3b7d8
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/main.nf
@@ -0,0 +1,57 @@
+process PICARD_ADDORREPLACEREADGROUPS {
+ tag "$meta.id"
+ label 'process_low'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/08/0861295baa7c01fc593a9da94e82b44a729dcaf8da92be8e565da109aa549b25/data' :
+ 'community.wave.seqera.io/library/picard:3.4.0--e9963040df0a9bf6' }"
+
+ input:
+ tuple val(meta), path(reads)
+ tuple val(meta2), path(fasta)
+ tuple val(meta3), path(fasta_index)
+
+ output:
+ tuple val(meta), path("*.bam") , emit: bam, optional: true
+ tuple val(meta), path("*.bai") , emit: bai, optional: true
+ tuple val(meta), path("*.cram"), emit: cram, optional: true
+ tuple val("${task.process}"), val('picard'), eval("picard AddOrReplaceReadGroups --version 2>&1 | sed -n 's/.*Version://p'"), topic: versions, emit: versions_picard
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def suffix = task.ext.suffix ?: "${reads.getExtension()}"
+ def reference = fasta ? "--REFERENCE_SEQUENCE ${fasta}" : ""
+ def avail_mem = 3072
+ if (!task.memory) {
+ log.info '[Picard AddOrReplaceReadGroups] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.'
+ } else {
+ avail_mem = (task.memory.mega*0.8).intValue()
+ }
+
+ if ("$reads" == "${prefix}.${suffix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+
+ """
+ picard \\
+ -Xmx${avail_mem}M \\
+ AddOrReplaceReadGroups \\
+ $args \\
+ $reference \\
+ --INPUT ${reads} \\
+ --OUTPUT ${prefix}.${suffix}
+
+ """
+
+ stub:
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def suffix = task.ext.suffix ?: "${reads.getExtension()}"
+ if ("$reads" == "${prefix}.${suffix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+ """
+ touch ${prefix}.${suffix}
+
+ """
+}
diff --git a/modules/nf-core/picard/addorreplacereadgroups/meta.yml b/modules/nf-core/picard/addorreplacereadgroups/meta.yml
new file mode 100644
index 00000000..6c3ed759
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/meta.yml
@@ -0,0 +1,117 @@
+name: picard_addorreplacereadgroups
+description: Assigns all the reads in a file to a single new read-group
+keywords:
+ - add
+ - replace
+ - read-group
+ - picard
+tools:
+ - picard:
+ description: |
+ A set of command line tools (in Java) for manipulating high-throughput sequencing (HTS)
+ data and formats such as SAM/BAM/CRAM and VCF.
+ homepage: https://broadinstitute.github.io/picard/
+ documentation: https://gatk.broadinstitute.org/hc/en-us/articles/360037226472-AddOrReplaceReadGroups-Picard-
+ tool_dev_url: https://github.com/broadinstitute/picard
+ licence: ["MIT"]
+ identifier: biotools:picard_tools
+input:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - reads:
+ type: file
+ description: Sequence reads file, can be SAM/BAM/CRAM format
+ pattern: "*.{bam,cram,sam}"
+ ontologies: []
+ - - meta2:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - fasta:
+ type: file
+ description: Reference genome file
+ pattern: "*.{fasta,fa,fasta.gz,fa.gz}"
+ ontologies: []
+ - - meta3:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - fasta_index:
+ type: file
+ description: Reference genome index file
+ pattern: "*.{fai,fasta.fai,fa.fai,fasta.gz.fai,fa.gz.fai}"
+ ontologies: []
+output:
+ bam:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.bam":
+ type: file
+ description: Output BAM file
+ pattern: "*.{bam}"
+ ontologies: []
+ bai:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.bai":
+ type: file
+ description: An optional BAM index file
+ pattern: "*.{bai}"
+ ontologies: []
+ cram:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.cram":
+ type: file
+ description: Output CRAM file
+ pattern: "*.{cram}"
+ ontologies: []
+ versions_picard:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - picard:
+ type: string
+ description: The tool name
+ - "picard AddOrReplaceReadGroups --version 2>&1 | sed -n 's/.*Version://p'":
+ type: string
+ description: The command used to generate the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - picard:
+ type: string
+ description: The tool name
+ - "picard AddOrReplaceReadGroups --version 2>&1 | sed -n 's/.*Version://p'":
+ type: string
+ description: The command used to generate the version of the tool
+
+authors:
+ - "@sateeshperi"
+ - "@mjcipriano"
+ - "@hseabolt"
+ - "@cmatKhan"
+ - "@muffato"
+maintainers:
+ - "@sateeshperi"
+ - "@mjcipriano"
+ - "@hseabolt"
+ - "@cmatKhan"
+ - "@muffato"
diff --git a/modules/nf-core/picard/addorreplacereadgroups/tests/bam.config b/modules/nf-core/picard/addorreplacereadgroups/tests/bam.config
new file mode 100644
index 00000000..3f37c2fd
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/tests/bam.config
@@ -0,0 +1,13 @@
+process {
+ withName: 'PICARD_ADDORREPLACEREADGROUPS'{
+ ext.prefix = { "${meta.id}.replaced"}
+ ext.args = {[
+ "--CREATE_INDEX",
+ "-LB ${meta.id}",
+ "-PL ILLUMINA",
+ "-PU bc1",
+ "-SM ${meta.id}"
+ ].join(' ').trim()}
+ }
+
+}
diff --git a/modules/nf-core/picard/addorreplacereadgroups/tests/cram.config b/modules/nf-core/picard/addorreplacereadgroups/tests/cram.config
new file mode 100644
index 00000000..966c14d7
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/tests/cram.config
@@ -0,0 +1,13 @@
+process {
+ withName: 'PICARD_ADDORREPLACEREADGROUPS'{
+ ext.prefix = { "${meta.id}.replaced"}
+ ext.args = {[
+ "-LB ${meta.id}",
+ "-PL ILLUMINA",
+ "-PU bc1",
+ "-SM ${meta.id}"
+ ].join(' ').trim()}
+ ext.suffix = { "cram" }
+ }
+
+}
diff --git a/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test b/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test
new file mode 100644
index 00000000..45729f3b
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test
@@ -0,0 +1,93 @@
+
+nextflow_process {
+
+ name "Test Process PICARD_ADDORREPLACEREADGROUPS"
+ script "../main.nf"
+ process "PICARD_ADDORREPLACEREADGROUPS"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "picard"
+ tag "picard/addorreplacereadgroups"
+
+ test("sarscov2 - bam") {
+ config "./bam.config"
+
+ when {
+ process {
+ """
+ input[0] = [ [:], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) ]
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.bam[0][1]).name,
+ file(process.out.bai[0][1]).name,
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()
+ },
+ )
+ }
+
+ }
+
+ test("homo_sapiens - cram") {
+ config "./cram.config"
+
+ when {
+ process {
+ """
+ input[0] = [
+ [ id:'test' ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), ]
+ ]
+ input[1] = [ [:], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]
+ input[2] = [ [:], file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.cram[0][1]).name,
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()
+ },
+ )
+ }
+
+ }
+
+ test("sarscov2 - bam - stub") {
+ config "./bam.config"
+ options "-stub"
+
+ when {
+ process {
+ """
+ input[0] = [ [:], file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) ]
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+
+ }
+
+}
diff --git a/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test.snap b/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test.snap
new file mode 100644
index 00000000..d2a99ee2
--- /dev/null
+++ b/modules/nf-core/picard/addorreplacereadgroups/tests/main.nf.test.snap
@@ -0,0 +1,94 @@
+{
+ "homo_sapiens - cram": {
+ "content": [
+ "test.replaced.cram",
+ {
+ "versions_picard": [
+ [
+ "PICARD_ADDORREPLACEREADGROUPS",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T09:36:16.966842212"
+ },
+ "sarscov2 - bam - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+
+ },
+ "null.replaced.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ "PICARD_ADDORREPLACEREADGROUPS",
+ "picard",
+ "3.4.0"
+ ]
+ ],
+ "bai": [
+
+ ],
+ "bam": [
+ [
+ {
+
+ },
+ "null.replaced.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+
+ ],
+ "versions_picard": [
+ [
+ "PICARD_ADDORREPLACEREADGROUPS",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T09:36:29.861163004"
+ },
+ "sarscov2 - bam": {
+ "content": [
+ "null.replaced.bam",
+ "null.replaced.bai",
+ {
+ "versions_picard": [
+ [
+ "PICARD_ADDORREPLACEREADGROUPS",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T09:36:00.935196996"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/picard/markduplicates/environment.yml b/modules/nf-core/picard/markduplicates/environment.yml
new file mode 100644
index 00000000..b4ac4fe0
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/environment.yml
@@ -0,0 +1,8 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+ - conda-forge
+ - bioconda
+dependencies:
+ # renovate: datasource=conda depName=bioconda/picard
+ - bioconda::picard=3.4.0
diff --git a/modules/nf-core/picard/markduplicates/main.nf b/modules/nf-core/picard/markduplicates/main.nf
new file mode 100644
index 00000000..10621e01
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/main.nf
@@ -0,0 +1,61 @@
+process PICARD_MARKDUPLICATES {
+ tag "$meta.id"
+ label 'process_medium'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/08/0861295baa7c01fc593a9da94e82b44a729dcaf8da92be8e565da109aa549b25/data' :
+ 'community.wave.seqera.io/library/picard:3.4.0--e9963040df0a9bf6' }"
+
+ input:
+ tuple val(meta), path(reads)
+ tuple val(meta2), path(fasta)
+ tuple val(meta3), path(fai)
+
+ output:
+ tuple val(meta), path("*.bam") , emit: bam, optional: true
+ tuple val(meta), path("*.bai") , emit: bai, optional: true
+ tuple val(meta), path("*.cram"), emit: cram, optional: true
+ tuple val(meta), path("*.metrics.txt"), emit: metrics
+ tuple val("${task.process}"), val('picard'), eval("picard MarkDuplicates --version 2>&1 | sed -n 's/^Version:*//p'"), topic: versions, emit: versions_picard
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def suffix = task.ext.suffix ?: "${reads.getExtension()}"
+ def reference = fasta ? "--REFERENCE_SEQUENCE ${fasta}" : ""
+ def avail_mem = 3072
+ if (!task.memory) {
+ log.info '[Picard MarkDuplicates] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.'
+ } else {
+ avail_mem = (task.memory.mega*0.8).intValue()
+ }
+
+ if ("$reads" == "${prefix}.${suffix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+
+ """
+ picard \\
+ -Xmx${avail_mem}M \\
+ MarkDuplicates \\
+ $args \\
+ --INPUT $reads \\
+ --OUTPUT ${prefix}.${suffix} \\
+ $reference \\
+ --METRICS_FILE ${prefix}.MarkDuplicates.metrics.txt
+
+ """
+
+ stub:
+ def prefix = task.ext.prefix ?: "${meta.id}"
+ def suffix = task.ext.suffix ?: "${reads.getExtension()}"
+ if ("$reads" == "${prefix}.${suffix}") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
+ """
+ touch ${prefix}.${suffix}
+ touch ${prefix}.${suffix}.bai
+ touch ${prefix}.MarkDuplicates.metrics.txt
+
+ """
+}
diff --git a/modules/nf-core/picard/markduplicates/meta.yml b/modules/nf-core/picard/markduplicates/meta.yml
new file mode 100644
index 00000000..0ec99c7f
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/meta.yml
@@ -0,0 +1,126 @@
+name: picard_markduplicates
+description: Locate and tag duplicate reads in a BAM file
+keywords:
+ - markduplicates
+ - pcr
+ - duplicates
+ - bam
+ - sam
+ - cram
+tools:
+ - picard:
+ description: |
+ A set of command line tools (in Java) for manipulating high-throughput sequencing (HTS)
+ data and formats such as SAM/BAM/CRAM and VCF.
+ homepage: https://broadinstitute.github.io/picard/
+ documentation: https://broadinstitute.github.io/picard/
+ licence: ["MIT"]
+ identifier: biotools:picard_tools
+input:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - reads:
+ type: file
+ description: Sequence reads file, can be SAM/BAM/CRAM format
+ pattern: "*.{bam,cram,sam}"
+ ontologies: []
+ - - meta2:
+ type: map
+ description: |
+ Groovy Map containing reference information
+ e.g. [ id:'genome' ]
+ - fasta:
+ type: file
+ description: Reference genome fasta file, required for CRAM input
+ pattern: "*.{fasta,fa}"
+ ontologies: []
+ - - meta3:
+ type: map
+ description: |
+ Groovy Map containing reference information
+ e.g. [ id:'genome' ]
+ - fai:
+ type: file
+ description: Reference genome fasta index
+ pattern: "*.{fai}"
+ ontologies: []
+output:
+ bam:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.bam":
+ type: file
+ description: BAM file with duplicate reads marked/removed
+ pattern: "*.{bam}"
+ ontologies: []
+ bai:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.bai":
+ type: file
+ description: An optional BAM index file. If desired, --CREATE_INDEX must be
+ passed as a flag
+ pattern: "*.{bai}"
+ ontologies: []
+ cram:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.cram":
+ type: file
+ description: Output CRAM file
+ pattern: "*.{cram}"
+ ontologies: []
+ metrics:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.metrics.txt":
+ type: file
+ description: Duplicate metrics file generated by picard
+ pattern: "*.{metrics.txt}"
+ ontologies: []
+ versions_picard:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - picard:
+ type: string
+ description: The tool name
+ - "picard MarkDuplicates --version 2>&1 | sed -n 's/^Version:*//p'":
+ type: string
+ description: The command used to generate the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - picard:
+ type: string
+ description: The tool name
+ - "picard MarkDuplicates --version 2>&1 | sed -n 's/^Version:*//p'":
+ type: string
+ description: The command used to generate the version of the tool
+
+authors:
+ - "@drpatelh"
+ - "@projectoriented"
+ - "@ramprasadn"
+maintainers:
+ - "@drpatelh"
+ - "@projectoriented"
+ - "@ramprasadn"
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test
new file mode 100644
index 00000000..e18723be
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test
@@ -0,0 +1,173 @@
+nextflow_process {
+
+ name "Test Process PICARD_MARKDUPLICATES"
+ script "../main.nf"
+ process "PICARD_MARKDUPLICATES"
+ config "./nextflow.config"
+ tag "modules"
+ tag "modules_nfcore"
+ tag "picard"
+ tag "picard/markduplicates"
+
+ test("sarscov2 [unsorted bam]") {
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.bam[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.findAll { key, val -> key.startsWith("versions") })
+ .match() }
+ )
+ }
+ }
+
+ test("sarscov2 [sorted bam]") {
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.bam[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.findAll { key, val -> key.startsWith("versions") })
+ .match() }
+ )
+ }
+ }
+
+ test("homo_sapiens [cram]") {
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ file(process.out.cram[0][1]).name,
+ path(process.out.metrics.get(0).get(1)).readLines()[0..2],
+ process.out.findAll { key, val -> key.startsWith("versions") })
+ .match() }
+ )
+ }
+ }
+
+ test("sarscov2 [unsorted bam] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("sarscov2 [sorted bam] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true)
+ ])
+ input[1] = [ [:], [] ]
+ input[2] = [ [:], [] ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+ test("homo_sapiens [cram] - stub") {
+ options "-stub"
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = Channel.of([
+ [ id:'genome' ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true)
+ ])
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+}
diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
new file mode 100644
index 00000000..84801384
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap
@@ -0,0 +1,329 @@
+{
+ "sarscov2 [sorted bam] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:46:02.077382134"
+ },
+ "sarscov2 [unsorted bam] - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "cram": [
+
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:45:49.985589186"
+ },
+ "sarscov2 [unsorted bam]": {
+ "content": [
+ "test.marked.bam",
+ [
+ "## htsjdk.samtools.metrics.StringHeader",
+ "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_DUP_STRATEGY FLOW_QUALITY_SUM_STRATEGY --FLOW_USE_END_IN_UNPAIRED_READS false --FLOW_USE_UNPAIRED_CLIPPED_END false --FLOW_UNPAIRED_END_UNCERTAINTY 0 --FLOW_UNPAIRED_START_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX
--OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+ "## htsjdk.samtools.metrics.StringHeader"
+ ],
+ {
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:42:49.704752548"
+ },
+ "sarscov2 [sorted bam]": {
+ "content": [
+ "test.marked.bam",
+ [
+ "## htsjdk.samtools.metrics.StringHeader",
+ "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_DUP_STRATEGY FLOW_QUALITY_SUM_STRATEGY --FLOW_USE_END_IN_UNPAIRED_READS false --FLOW_USE_UNPAIRED_CLIPPED_END false --FLOW_UNPAIRED_END_UNCERTAINTY 0 --FLOW_UNPAIRED_START_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+ "## htsjdk.samtools.metrics.StringHeader"
+ ],
+ {
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:44:17.407572621"
+ },
+ "homo_sapiens [cram]": {
+ "content": [
+ "test.marked.cram",
+ [
+ "## htsjdk.samtools.metrics.StringHeader",
+ "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.cram --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_DUP_STRATEGY FLOW_QUALITY_SUM_STRATEGY --FLOW_USE_END_IN_UNPAIRED_READS false --FLOW_USE_UNPAIRED_CLIPPED_END false --FLOW_UNPAIRED_END_UNCERTAINTY 0 --FLOW_UNPAIRED_START_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false",
+ "## htsjdk.samtools.metrics.StringHeader"
+ ],
+ {
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:45:33.412603893"
+ },
+ "homo_sapiens [cram] - stub": {
+ "content": [
+ {
+ "0": [
+
+ ],
+ "1": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ],
+ "bai": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "bam": [
+
+ ],
+ "cram": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "metrics": [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.marked.MarkDuplicates.metrics.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_picard": [
+ [
+ "PICARD_MARKDUPLICATES",
+ "picard",
+ "3.4.0"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
+ },
+ "timestamp": "2026-02-02T11:46:18.599127485"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config
new file mode 100644
index 00000000..02818dd6
--- /dev/null
+++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config
@@ -0,0 +1,6 @@
+process {
+ withName: PICARD_MARKDUPLICATES {
+ ext.prefix = { "${meta.id}.marked" }
+ ext.args = '--ASSUME_SORT_ORDER queryname'
+ }
+}
diff --git a/modules/nf-core/pilon/main.nf b/modules/nf-core/pilon/main.nf
index 92cac75a..2a3cbe93 100644
--- a/modules/nf-core/pilon/main.nf
+++ b/modules/nf-core/pilon/main.nf
@@ -18,7 +18,8 @@ process PILON {
tuple val(meta), path("*.change"), emit: change_record , optional : true
tuple val(meta), path("*.bed") , emit: tracks_bed , optional : true
tuple val(meta), path("*.wig") , emit: tracks_wig , optional : true
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('pilon'), eval("pilon --version | sed 's/^.*version //; s/ .*\$//'"), emit: versions_pilon, topic: versions
+
when:
task.ext.when == null || task.ext.when
@@ -43,11 +44,6 @@ process PILON {
--output ${prefix} \\
$args \\
--$pilon_mode $bam
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- pilon: \$(echo \$(pilon --version) | sed 's/^.*version //; s/ .*\$//' )
- END_VERSIONS
"""
stub:
@@ -60,11 +56,6 @@ process PILON {
touch ${prefix}.change
touch ${prefix}.bed
touch ${prefix}.wig
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- pilon: \$(echo \$(pilon --version) | sed 's/^.*version //; s/ .*\$//' )
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/pilon/meta.yml b/modules/nf-core/pilon/meta.yml
index 38d9006d..db0e96d9 100644
--- a/modules/nf-core/pilon/meta.yml
+++ b/modules/nf-core/pilon/meta.yml
@@ -1,6 +1,6 @@
name: "pilon"
-description: Automatically improve draft assemblies and find variation among strains,
- including large event detection
+description: Automatically improve draft assemblies and find variation among
+ strains, including large event detection
keywords:
- polishing
- assembly
@@ -13,7 +13,8 @@ tools:
documentation: "https://github.com/broadinstitute/pilon/wiki/Requirements-&-Usage"
tool_dev_url: "https://github.com/broadinstitute/pilon"
doi: "10.1371/journal.pone.0112963"
- licence: ["GPL-2.0-or-later"]
+ licence:
+ - "GPL-2.0-or-later"
identifier: biotools:pilon
input:
- - meta:
@@ -25,6 +26,7 @@ input:
type: file
description: FASTA of the input genome
pattern: "*.{fasta}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -34,22 +36,28 @@ input:
type: file
description: BAM file of reads aligned to the input genome
pattern: "*.{bam}"
+ ontologies: []
- bai:
type: file
description: BAI file (BAM index) of BAM reads aligned to the input genome
pattern: "*.{bai}"
- - - pilon_mode:
- type: string
- description: Indicates the type of bam file used (frags for paired-end sequencing
- of DNA fragments, such as Illumina paired-end reads of fragment size <1000bp,
- jumps for paired sequencing data of larger insert size, such as Illumina mate
- pair libraries, typically of insert size >1000bp, unpaired for unpaired sequencing
- reads, bam will automatically classify the BAM as one of the three types above
- (version 1.17 and higher).
- enum: ["frags", "jumps", "unpaired", "bam"]
+ ontologies: []
+ - pilon_mode:
+ type: string
+ description: Indicates the type of bam file used (frags for paired-end
+ sequencing of DNA fragments, such as Illumina paired-end reads of fragment
+ size <1000bp, jumps for paired sequencing data of larger insert size, such
+ as Illumina mate pair libraries, typically of insert size >1000bp,
+ unpaired for unpaired sequencing reads, bam will automatically classify
+ the BAM as one of the three types above (version 1.17 and higher).
+ enum:
+ - "frags"
+ - "jumps"
+ - "unpaired"
+ - "bam"
output:
- - improved_assembly:
- - meta:
+ improved_assembly:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -58,8 +66,9 @@ output:
type: file
description: fasta file, improved assembly
pattern: "*.{fasta}"
- - vcf:
- - meta:
+ ontologies: []
+ vcf:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -68,44 +77,64 @@ output:
type: file
description: Pilon variant output
pattern: "*.{vcf}"
- - change_record:
- - meta:
+ ontologies: []
+ change_record:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*.change":
type: file
- description: file containing a space-delimited record of every change made in
- the assembly as instructed by the --fix option
+ description: file containing a space-delimited record of every change
+ made in the assembly as instructed by the --fix option
pattern: "*.{change}"
- - tracks_bed:
- - meta:
+ ontologies: []
+ tracks_bed:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*.bed":
type: file
- description: files that may be viewed in genome browsers such as IGV, GenomeView,
- and other applications that support these formats
+ description: files that may be viewed in genome browsers such as IGV,
+ GenomeView, and other applications that support these formats
pattern: "*.{bed}"
- - tracks_wig:
- - meta:
+ ontologies: []
+ tracks_wig:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*.wig":
type: file
- description: files that may be viewed in genome browsers such as IGV, GenomeView,
- and other applications that support these formats
+ description: files that may be viewed in genome browsers such as IGV,
+ GenomeView, and other applications that support these formats
pattern: "*.{wig}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_pilon:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - pilon:
+ type: string
+ description: The name of the tool
+ - pilon --version | sed 's/^.*version //; s/ .*\$//':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - pilon:
+ type: string
+ description: The name of the tool
+ - pilon --version | sed 's/^.*version //; s/ .*\$//':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@scorreard"
maintainers:
diff --git a/modules/nf-core/pilon/tests/main.nf.test.snap b/modules/nf-core/pilon/tests/main.nf.test.snap
index 91208228..d8a284f1 100644
--- a/modules/nf-core/pilon/tests/main.nf.test.snap
+++ b/modules/nf-core/pilon/tests/main.nf.test.snap
@@ -48,7 +48,11 @@
]
],
"5": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
],
"change_record": [
[
@@ -95,16 +99,20 @@
"test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ "versions_pilon": [
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:08:00.664784809",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-27T13:18:02.740029689"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo sapiens bam": {
"content": [
@@ -131,7 +139,11 @@
],
"5": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
],
"change_record": [
@@ -154,16 +166,20 @@
"vcf": [
],
- "versions": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ "versions_pilon": [
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:07:51.999859591",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-14T11:20:04.988498289"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo sapiens frags": {
"content": [
@@ -190,7 +206,11 @@
],
"5": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
],
"change_record": [
@@ -213,16 +233,20 @@
"vcf": [
],
- "versions": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ "versions_pilon": [
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:10:08.79891187",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-14T11:29:53.995788701"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"homo sapiens frags - stub": {
"content": [
@@ -273,7 +297,11 @@
]
],
"5": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
],
"change_record": [
[
@@ -320,15 +348,19 @@
"test.vcf:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,73f60b48e5c3838296b66520b61a551a"
+ "versions_pilon": [
+ [
+ "PILON",
+ "pilon",
+ "1.24"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:08:13.764321711",
"meta": {
- "nf-test": "0.8.4",
- "nextflow": "24.04.2"
- },
- "timestamp": "2024-06-27T13:18:31.732478412"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/porechop/porechop/main.nf b/modules/nf-core/porechop/porechop/main.nf
deleted file mode 100644
index 34daf3e8..00000000
--- a/modules/nf-core/porechop/porechop/main.nf
+++ /dev/null
@@ -1,49 +0,0 @@
-process PORECHOP_PORECHOP {
- tag "$meta.id"
- label 'process_medium'
-
- conda "${moduleDir}/environment.yml"
- container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/2b/2bce1f10c51906a66c4c4d3a7485394f67e304177192ad1cce6cf586a3a18bae/data' :
- 'community.wave.seqera.io/library/porechop_pigz:d1655e5b5bad786c' }"
-
-
- input:
- tuple val(meta), path(reads)
-
- output:
- tuple val(meta), path("*.fastq.gz"), emit: reads
- tuple val(meta), path("*.log") , emit: log
- path "versions.yml" , emit: versions
-
- when:
- task.ext.when == null || task.ext.when
-
- script:
- def args = task.ext.args ?: ''
- def prefix = task.ext.prefix ?: "${meta.id}"
- """
- porechop \\
- -i $reads \\
- -t $task.cpus \\
- $args \\
- -o ${prefix}.fastq.gz \\
- > ${prefix}.log
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- porechop: \$( porechop --version )
- END_VERSIONS
- """
-
- stub:
- def prefix = task.ext.prefix ?: "${meta.id}"
- """
- touch ${prefix}.fastq
- gzip ${prefix}.fastq
- touch ${prefix}.log
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- porechop: \$( porechop --version )
- END_VERSIONS
- """
-}
diff --git a/modules/nf-core/porechop/porechop/meta.yml b/modules/nf-core/porechop/porechop/meta.yml
deleted file mode 100644
index 9e61c054..00000000
--- a/modules/nf-core/porechop/porechop/meta.yml
+++ /dev/null
@@ -1,71 +0,0 @@
-name: "porechop_porechop"
-description: Adapter removal and demultiplexing of Oxford Nanopore reads
-keywords:
- - adapter
- - nanopore
- - demultiplexing
-tools:
- - porechop:
- description: Adapter removal and demultiplexing of Oxford Nanopore reads
- homepage: "https://github.com/rrwick/Porechop"
- documentation: "https://github.com/rrwick/Porechop"
- tool_dev_url: "https://github.com/rrwick/Porechop"
- doi: "10.1099/mgen.0.000132"
- licence: ["GPL v3"]
- identifier: ""
-input:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: fastq/fastq.gz file
- pattern: "*.{fastq,fastq.gz,fq,fq.gz}"
-output:
- - reads:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*.fastq.gz":
- type: file
- description: Demultiplexed and/or adapter-trimmed fastq.gz file
- pattern: "*.{fastq.gz}"
- - log:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*.log":
- type: file
- description: Log file containing stdout information
- pattern: "*.log"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
-authors:
- - "@ggabernet"
- - "@jasmezz"
- - "@d4straub"
- - "@LaurenceKuhl"
- - "@SusiJo"
- - "@jonasscheid"
- - "@jonoave"
- - "@GokceOGUZ"
- - "@jfy133"
-maintainers:
- - "@ggabernet"
- - "@jasmezz"
- - "@d4straub"
- - "@LaurenceKuhl"
- - "@SusiJo"
- - "@jonasscheid"
- - "@jonoave"
- - "@GokceOGUZ"
- - "@jfy133"
diff --git a/modules/nf-core/porechop/porechop/tests/main.nf.test b/modules/nf-core/porechop/porechop/tests/main.nf.test
deleted file mode 100644
index ed3f6986..00000000
--- a/modules/nf-core/porechop/porechop/tests/main.nf.test
+++ /dev/null
@@ -1,62 +0,0 @@
-nextflow_process {
-
- name "Test Process PORECHOP_PORECHOP"
- script "../main.nf"
- process "PORECHOP_PORECHOP"
- config "./nextflow.config"
-
- tag "modules"
- tag "modules_nfcore"
- tag "porechop"
- tag "porechop/porechop"
-
- test("sarscov2 - nanopore - fastq") {
-
- when {
- process {
- """
- input[0] = [
- [ id:'test', single_end:true ],
- file(params.modules_testdata_base_path + 'genomics/sarscov2/nanopore/fastq/test.fastq.gz', checkIfExists: true)
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out.reads).match("reads") },
- { assert snapshot(process.out.versions).match("versions") },
- // complete log is not stable. These first lines should be stable
- { assert snapshot(path(process.out.log.get(0).get(1)).readLines()[0..7]).match("log")}
- )
- }
-
- }
-
-
- test("stub") {
- options "-stub"
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end:true ],
- []
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() }
- )
- }
-
- }
-
-
-}
diff --git a/modules/nf-core/porechop/porechop/tests/main.nf.test.snap b/modules/nf-core/porechop/porechop/tests/main.nf.test.snap
deleted file mode 100644
index cf544d2d..00000000
--- a/modules/nf-core/porechop/porechop/tests/main.nf.test.snap
+++ /dev/null
@@ -1,88 +0,0 @@
-{
- "versions": {
- "content": [
- [
- "versions.yml:md5,712c0753b56d0fb530092dfb5bdf2e5c"
- ]
- ],
- "timestamp": "2023-12-18T07:47:16.83444"
- },
- "log": {
- "content": [
- [
- "",
- "\u001b[1m\u001b[4mLoading reads\u001b[0m",
- "test.fastq.gz",
- "100 reads loaded",
- "",
- "",
- "\u001b[1m\u001b[4mLooking for known adapter sets\u001b[0m",
- ""
- ]
- ],
- "timestamp": "2023-12-18T07:47:16.853899"
- },
- "reads": {
- "content": [
- [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_porechop.fastq.gz:md5,886fdb859fb50e0dddd35007bcff043e"
- ]
- ]
- ],
- "timestamp": "2023-12-18T07:47:16.811393"
- },
- "stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_porechop.fastq.gz:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_porechop.log:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
- "versions.yml:md5,712c0753b56d0fb530092dfb5bdf2e5c"
- ],
- "log": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_porechop.log:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "reads": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_porechop.fastq.gz:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,712c0753b56d0fb530092dfb5bdf2e5c"
- ]
- }
- ],
- "timestamp": "2023-12-18T07:47:37.814949"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/porechop/porechop/tests/nextflow.config b/modules/nf-core/porechop/porechop/tests/nextflow.config
deleted file mode 100644
index a9ecf7b6..00000000
--- a/modules/nf-core/porechop/porechop/tests/nextflow.config
+++ /dev/null
@@ -1,9 +0,0 @@
-process {
-
-
- withName: PORECHOP_PORECHOP {
- ext.args = ''
- ext.prefix = { "${meta.id}_porechop" }
- }
-
-}
diff --git a/modules/nf-core/ragtag/patch/main.nf b/modules/nf-core/ragtag/patch/main.nf
index 4e8cf455..cfd8e35a 100644
--- a/modules/nf-core/ragtag/patch/main.nf
+++ b/modules/nf-core/ragtag/patch/main.nf
@@ -8,11 +8,11 @@ process RAGTAG_PATCH {
: 'biocontainers/ragtag:2.1.0--pyhb7b1952_0'}"
input:
- tuple val(meta), path(target, name: 'target/*')
+ tuple val(meta), path(target, name: 'target/*')
tuple val(meta2), path(query, name: 'query/*')
tuple val(meta3), path(exclude)
tuple val(meta4), path(skip)
-
+
output:
tuple val(meta), path("*.patch.fasta"), emit: patch_fasta
tuple val(meta), path("*.patch.agp"), emit: patch_agp
@@ -23,7 +23,8 @@ process RAGTAG_PATCH {
tuple val(meta), path("*.rename.agp"), emit: qry_rename_agp, optional: true
tuple val(meta), path("*.rename.fasta"), emit: qry_rename_fasta, optional: true
tuple val(meta), path("*.patch.err"), emit: stderr
- path "versions.yml", emit: versions
+ tuple val("${task.process}"), val('ragtag'), eval("ragtag.py -v | sed 's/v//'"), emit: versions_ragtag, topic: versions
+
when:
task.ext.when == null || task.ext.when
@@ -56,7 +57,7 @@ process RAGTAG_PATCH {
${arg_exclude} \\
${arg_skip} \\
${args} \\
- 2> >( tee ${prefix}.stderr.log >&2 ) \\
+ 2>| >( tee ${prefix}.stderr.log >&2 ) \\
| tee ${prefix}.stdout.log
kill -TERM "\$tailpid"
@@ -76,14 +77,9 @@ process RAGTAG_PATCH {
mv ${prefix}/ragtag.patch.err ${prefix}.patch.err
# Move the assembly files from prefix folder, and add prefix
for alignment_file in \$(ls ${prefix}/ragtag.patch.asm.*);
- do
+ do
mv "\$alignment_file" "\${alignment_file/${prefix}\\//${prefix}_}"
done
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- ragtag: \$(echo \$(ragtag.py -v | sed 's/v//'))
- END_VERSIONS
"""
stub:
@@ -101,9 +97,5 @@ process RAGTAG_PATCH {
touch ${prefix}.rename.fasta
touch ${prefix}.ragtag.patch.asm.1
touch ${prefix}.patch.err
-
- cat <<-END_VERSIONS > versions.yml
- ragtag: \$(echo \$(ragtag.py -v | sed 's/v//'))
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/ragtag/patch/meta.yml b/modules/nf-core/ragtag/patch/meta.yml
index d74ee3d2..30976dba 100644
--- a/modules/nf-core/ragtag/patch/meta.yml
+++ b/modules/nf-core/ragtag/patch/meta.yml
@@ -1,7 +1,6 @@
name: "ragtag_patch"
description: "Homology-based assembly patching: Make continuous joins and fill gaps
in 'target.fa' using sequences from 'query.fa'"
-
keywords:
- assembly
- consensus
@@ -14,7 +13,8 @@ tools:
documentation: "https://github.com/malonge/RagTag/wiki"
tool_dev_url: "https://github.com/malonge/RagTag"
doi: "10.1186/s13059-022-02823-7"
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:ragtag
input:
- - meta:
@@ -26,6 +26,7 @@ input:
type: file
description: Target assembly
pattern: "*.{fasta,fasta.gz}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -35,6 +36,7 @@ input:
type: file
description: Query assembly
pattern: "*.{fasta,fasta.gz}"
+ ontologies: []
- - meta3:
type: map
description: |
@@ -44,6 +46,7 @@ input:
type: file
description: list of target sequences to ignore
pattern: "*.txt"
+ ontologies: []
- - meta4:
type: map
description: |
@@ -53,9 +56,10 @@ input:
type: file
description: list of query sequences to ignore
pattern: "*.txt"
+ ontologies: []
output:
- - patch_fasta:
- - meta:
+ patch_fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -64,8 +68,9 @@ output:
type: file
description: FASTA file containing the patched assembly
pattern: "*.patch.fasta"
- - patch_agp:
- - meta:
+ ontologies: []
+ patch_agp:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -74,19 +79,22 @@ output:
type: file
description: AGP file defining how ragtag.patch.fasta is built
pattern: "*.patch.agp"
- - patch_components_fasta:
- - meta:
+ ontologies: []
+ patch_components_fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test' ]
- "*.comps.fasta":
type: file
- description: The split target assembly and the renamed query assembly combined
- into one FASTA file. This file contains all components in ragtag.patch.agp
+ description: The split target assembly and the renamed query assembly
+ combined into one FASTA file. This file contains all components in
+ ragtag.patch.agp
pattern: "*.comps.fasta"
- - assembly_alignments:
- - meta:
+ ontologies: []
+ assembly_alignments:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -95,18 +103,21 @@ output:
type: file
description: Assembly alignment files
pattern: "*.ragtag.patch.asm.*"
- - target_splits_agp:
- - meta:
+ ontologies: []
+ target_splits_agp:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test' ]
- "*.ctg.agp":
type: file
- description: An AGP file defining how the target assembly was split at gaps
+ description: An AGP file defining how the target assembly was split at
+ gaps
pattern: "*.ctg.agp"
- - target_splits_fasta:
- - meta:
+ ontologies: []
+ target_splits_fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -115,8 +126,9 @@ output:
type: file
description: FASTA file containing the target assembly split at gaps
pattern: "*.ctg.fasta"
- - qry_rename_agp:
- - meta:
+ ontologies: []
+ qry_rename_agp:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -125,18 +137,21 @@ output:
type: file
description: An AGP file defining the new names for query sequences
pattern: "*.rename.agp"
- - qry_rename_fasta:
- - meta:
+ ontologies: []
+ qry_rename_fasta:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test' ]
- "*.rename.fasta":
type: file
- description: A FASTA file with the original query sequence, but with new names
+ description: A FASTA file with the original query sequence, but with new
+ names
pattern: "*.rename.fasta"
- - stderr:
- - meta:
+ ontologies: []
+ stderr:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -145,11 +160,28 @@ output:
type: file
description: Standard error logging for all external RagTag commands
pattern: "*.patch.err"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_ragtag:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - ragtag:
+ type: string
+ description: The name of the tool
+ - ragtag.py -v | sed 's/v//':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - ragtag:
+ type: string
+ description: The name of the tool
+ - ragtag.py -v | sed 's/v//':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@nschan"
maintainers:
diff --git a/modules/nf-core/ragtag/patch/tests/main.nf.test b/modules/nf-core/ragtag/patch/tests/main.nf.test
index a7c0fee8..e532a95d 100644
--- a/modules/nf-core/ragtag/patch/tests/main.nf.test
+++ b/modules/nf-core/ragtag/patch/tests/main.nf.test
@@ -44,7 +44,7 @@ test("A. thaliana Col-0 test data - ragtag - patch") {
process.out.patch_components_fasta,
process.out.target_splits_agp,
process.out.target_splits_fasta,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match()
},
)
diff --git a/modules/nf-core/ragtag/patch/tests/main.nf.test.snap b/modules/nf-core/ragtag/patch/tests/main.nf.test.snap
index b1444692..db994efe 100644
--- a/modules/nf-core/ragtag/patch/tests/main.nf.test.snap
+++ b/modules/nf-core/ragtag/patch/tests/main.nf.test.snap
@@ -75,7 +75,11 @@
]
],
"9": [
- "versions.yml:md5,cecbb39907d607affa6522e395b78a1f"
+ [
+ "RAGTAG_PATCH",
+ "ragtag",
+ "2.1.0"
+ ]
],
"assembly_alignments": [
[
@@ -149,16 +153,20 @@
"test.ctg.fasta:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,cecbb39907d607affa6522e395b78a1f"
+ "versions_ragtag": [
+ [
+ "RAGTAG_PATCH",
+ "ragtag",
+ "2.1.0"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:14:07.370603076",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-04T14:10:01.648597527"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
},
"A. thaliana Col-0 test data - ragtag - patch": {
"content": [
@@ -202,14 +210,20 @@
"test.ctg.fasta:md5,5cf615df690061ab15e4fee62abf3ebc"
]
],
- [
- "versions.yml:md5,4c0992a27edf294209711ce4f181eb5a"
- ]
+ {
+ "versions_ragtag": [
+ [
+ "RAGTAG_PATCH",
+ "ragtag",
+ "2.1.0"
+ ]
+ ]
+ }
],
+ "timestamp": "2026-02-16T15:55:07.632218179",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-04T14:25:42.121285998"
+ "nf-test": "0.9.4",
+ "nextflow": "25.04.8"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/ragtag/scaffold/main.nf b/modules/nf-core/ragtag/scaffold/main.nf
index c3930c12..e96bfc05 100644
--- a/modules/nf-core/ragtag/scaffold/main.nf
+++ b/modules/nf-core/ragtag/scaffold/main.nf
@@ -17,7 +17,7 @@ process RAGTAG_SCAFFOLD {
tuple val(meta), path("*.fasta"), emit: corrected_assembly
tuple val(meta), path("*.agp"), emit: corrected_agp
tuple val(meta), path("*.stats"), emit: corrected_stats
- path "versions.yml", emit: versions
+ tuple val("${task.process}"), val('ragtag'), eval("ragtag.py -v | sed 's/v//'"), emit: versions_ragtag, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -51,17 +51,12 @@ process RAGTAG_SCAFFOLD {
${arg_skip} \\
${arg_hard_skip} \\
${args} \\
- 2> >( tee ${prefix}.stderr.log >&2 ) \\
+ 2>| >( tee ${prefix}.stderr.log >&2 ) \\
| tee ${prefix}.stdout.log
mv ${prefix}/ragtag.scaffold.fasta ${prefix}.fasta
mv ${prefix}/ragtag.scaffold.agp ${prefix}.agp
mv ${prefix}/ragtag.scaffold.stats ${prefix}.stats
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- ragtag: \$(echo \$(ragtag.py -v | sed 's/v//'))
- END_VERSIONS
"""
stub:
@@ -74,9 +69,5 @@ process RAGTAG_SCAFFOLD {
touch ${prefix}.fasta
touch ${prefix}.agp
touch ${prefix}.stats
-
- cat <<-END_VERSIONS > versions.yml
- ragtag: \$(echo \$(ragtag.py -v | sed 's/v//'))
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/ragtag/scaffold/meta.yml b/modules/nf-core/ragtag/scaffold/meta.yml
index 62eb0e49..5f3127fc 100644
--- a/modules/nf-core/ragtag/scaffold/meta.yml
+++ b/modules/nf-core/ragtag/scaffold/meta.yml
@@ -1,4 +1,3 @@
-# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json
name: ragtag_scaffold
description: |
Scaffolding is the process of ordering and orienting draft assembly (query)
@@ -18,9 +17,9 @@ tools:
documentation: "https://github.com/malonge/RagTag/wiki"
tool_dev_url: "https://github.com/malonge/RagTag"
doi: "10.1186/s13059-022-02823-7"
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:ragtag
-
input:
- - meta:
type: map
@@ -31,6 +30,7 @@ input:
type: file
description: Assembly to be scaffolded
pattern: "*.{fasta,fasta.gz,fa,fa.gz}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -40,6 +40,7 @@ input:
type: file
description: Reference assembly
pattern: "*.{fasta,fasta.gz,fa,fa.gz}"
+ ontologies: []
- - meta3:
type: map
description: |
@@ -49,6 +50,7 @@ input:
type: file
description: list of target sequences to ignore
pattern: "*.txt"
+ ontologies: []
- - meta4:
type: map
description: |
@@ -58,14 +60,16 @@ input:
type: file
description: list of query sequences to leave unplaced
pattern: "*.txt"
+ ontologies: []
- hard_skip:
type: file
- description: list of query headers to leave unplaced and exclude from 'chr0'
- ('-C')
+ description: list of query headers to leave unplaced and exclude from
+ 'chr0' ('-C')
pattern: "*.txt"
+ ontologies: []
output:
- - corrected_assembly:
- - meta:
+ corrected_assembly:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -74,8 +78,9 @@ output:
type: file
description: FASTA file containing the patched assembly
pattern: "*.fasta"
- - corrected_agp:
- - meta:
+ ontologies: []
+ corrected_agp:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -84,8 +89,9 @@ output:
type: file
description: agp file defining how corrected_assembly is built
pattern: "*.agp"
- - corrected_stats:
- - meta:
+ ontologies: []
+ corrected_stats:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -94,12 +100,28 @@ output:
type: file
description: Statistics on the scaffold
pattern: "*.stats"
-
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_ragtag:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - ragtag:
+ type: string
+ description: The name of the tool
+ - ragtag.py -v | sed 's/v//':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - ragtag:
+ type: string
+ description: The name of the tool
+ - ragtag.py -v | sed 's/v//':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@nschan"
maintainers:
diff --git a/modules/nf-core/ragtag/scaffold/tests/main.nf.test b/modules/nf-core/ragtag/scaffold/tests/main.nf.test
index 51b42642..84e6b09e 100644
--- a/modules/nf-core/ragtag/scaffold/tests/main.nf.test
+++ b/modules/nf-core/ragtag/scaffold/tests/main.nf.test
@@ -30,7 +30,7 @@ nextflow_process {
[],
[],
[]
- ]
+ ]
"""
}
}
@@ -66,7 +66,7 @@ nextflow_process {
[],
[],
[]
- ]
+ ]
"""
}
}
diff --git a/modules/nf-core/ragtag/scaffold/tests/main.nf.test.snap b/modules/nf-core/ragtag/scaffold/tests/main.nf.test.snap
index e4faf0b0..cb27f70a 100644
--- a/modules/nf-core/ragtag/scaffold/tests/main.nf.test.snap
+++ b/modules/nf-core/ragtag/scaffold/tests/main.nf.test.snap
@@ -27,7 +27,11 @@
]
],
"3": [
- "versions.yml:md5,48710c1720f668d8ba3397f99892959e"
+ [
+ "RAGTAG_SCAFFOLD",
+ "ragtag",
+ "2.1.0"
+ ]
],
"corrected_agp": [
[
@@ -53,16 +57,20 @@
"test.stats:md5,209e973e4bac1653b8d5fddb7fa13b63"
]
],
- "versions": [
- "versions.yml:md5,48710c1720f668d8ba3397f99892959e"
+ "versions_ragtag": [
+ [
+ "RAGTAG_SCAFFOLD",
+ "ragtag",
+ "2.1.0"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:16:15.735574744",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-04T13:37:54.181644032"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
},
"A. thaliana Col-0 test data - ragtag - scaffold - stub": {
"content": [
@@ -92,7 +100,11 @@
]
],
"3": [
- "versions.yml:md5,cecbb39907d607affa6522e395b78a1f"
+ [
+ "RAGTAG_SCAFFOLD",
+ "ragtag",
+ "2.1.0"
+ ]
],
"corrected_agp": [
[
@@ -118,15 +130,19 @@
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,cecbb39907d607affa6522e395b78a1f"
+ "versions_ragtag": [
+ [
+ "RAGTAG_SCAFFOLD",
+ "ragtag",
+ "2.1.0"
+ ]
]
}
],
+ "timestamp": "2026-02-16T15:16:24.915889235",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-04-04T13:38:21.635495713"
+ "nf-test": "0.9.4",
+ "nextflow": "26.01.1"
+ }
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/faidx/environment.yml b/modules/nf-core/samtools/faidx/environment.yml
new file mode 100644
index 00000000..89e12a64
--- /dev/null
+++ b/modules/nf-core/samtools/faidx/environment.yml
@@ -0,0 +1,10 @@
+---
+# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
+channels:
+ - conda-forge
+ - bioconda
+dependencies:
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/faidx/main.nf b/modules/nf-core/samtools/faidx/main.nf
new file mode 100644
index 00000000..97bfb578
--- /dev/null
+++ b/modules/nf-core/samtools/faidx/main.nf
@@ -0,0 +1,49 @@
+process SAMTOOLS_FAIDX {
+ tag "$fasta"
+ label 'process_single'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
+
+ input:
+ tuple val(meta), path(fasta), path(fai)
+ val get_sizes
+
+ output:
+ tuple val(meta), path ("*.{fa,fasta}") , emit: fa, optional: true
+ tuple val(meta), path ("*.sizes") , emit: sizes, optional: true
+ tuple val(meta), path ("*.fai") , emit: fai, optional: true
+ tuple val(meta), path ("*.gzi") , emit: gzi, optional: true
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), topic: versions, emit: versions_samtools
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ def get_sizes_command = get_sizes ? "cut -f 1,2 ${fasta}.fai > ${fasta}.sizes" : ''
+ """
+ samtools \\
+ faidx \\
+ $fasta \\
+ $args
+
+ ${get_sizes_command}
+ """
+
+ stub:
+ def match = (task.ext.args =~ /-o(?:utput)?\s(.*)\s?/).findAll()
+ def fastacmd = match[0] ? "touch ${match[0][1]}" : ''
+ def get_sizes_command = get_sizes ? "touch ${fasta}.sizes" : ''
+ """
+ ${fastacmd}
+ touch ${fasta}.fai
+ if [[ "${fasta.extension}" == "gz" ]]; then
+ touch ${fasta}.gzi
+ fi
+
+ ${get_sizes_command}
+ """
+}
diff --git a/modules/nf-core/samtools/faidx/meta.yml b/modules/nf-core/samtools/faidx/meta.yml
new file mode 100644
index 00000000..80aae1da
--- /dev/null
+++ b/modules/nf-core/samtools/faidx/meta.yml
@@ -0,0 +1,112 @@
+name: samtools_faidx
+description: Index FASTA file, and optionally generate a file of chromosome
+ sizes
+keywords:
+ - index
+ - fasta
+ - faidx
+ - chromosome
+tools:
+ - samtools:
+ description: |
+ SAMtools is a set of utilities for interacting with and post-processing
+ short DNA sequence read alignments in the SAM, BAM and CRAM formats, written by Heng Li.
+ These files are generated as output by short read aligners like BWA.
+ homepage: http://www.htslib.org/
+ documentation: http://www.htslib.org/doc/samtools.html
+ doi: 10.1093/bioinformatics/btp352
+ licence:
+ - "MIT"
+ identifier: biotools:samtools
+input:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing reference information
+ e.g. [ id:'test' ]
+ - fasta:
+ type: file
+ description: FASTA file
+ pattern: "*.{fa,fasta}"
+ ontologies: []
+ - fai:
+ type: file
+ description: FASTA index file
+ pattern: "*.{fai}"
+ ontologies: []
+ - get_sizes:
+ type: boolean
+ description: use cut to get the sizes of the index (true) or not (false)
+output:
+ fa:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.{fa,fasta}":
+ type: file
+ description: FASTA file
+ pattern: "*.{fa}"
+ ontologies: []
+ sizes:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.sizes":
+ type: file
+ description: File containing chromosome lengths
+ pattern: "*.{sizes}"
+ ontologies: []
+ fai:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.fai":
+ type: file
+ description: FASTA index file
+ pattern: "*.{fai}"
+ ontologies: []
+ gzi:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "*.gzi":
+ type: file
+ description: Optional gzip index file for compressed inputs
+ pattern: "*.gzi"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - samtools:
+ type: string
+ description: The tool name
+ - "samtools version | sed '1!d;s/.* //'":
+ type: eval
+ description: The command used to generate the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - samtools:
+ type: string
+ description: The tool name
+ - "samtools version | sed '1!d;s/.* //'":
+ type: eval
+ description: The command used to generate the version of the tool
+authors:
+ - "@drpatelh"
+ - "@ewels"
+ - "@phue"
+maintainers:
+ - "@maxulysse"
+ - "@phue"
diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test
new file mode 100644
index 00000000..9a86db86
--- /dev/null
+++ b/modules/nf-core/samtools/faidx/tests/main.nf.test
@@ -0,0 +1,253 @@
+nextflow_process {
+
+ name "Test Process SAMTOOLS_FAIDX"
+ script "../main.nf"
+ process "SAMTOOLS_FAIDX"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "samtools"
+ tag "samtools/faidx"
+ config "./nextflow.config"
+
+ test("test_samtools_faidx") {
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ []
+ ]
+ input[1] = false
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_bgzip") {
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true),
+ []
+ ]
+ input[1] = false
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_fasta") {
+
+ when {
+ params {
+ module_args = 'MT192765.1 -o extract.fa'
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)
+ ]
+ input[1] = false
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_stub_fasta") {
+
+ options "-stub"
+ when {
+ params {
+ module_args = '-o extract.fa'
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true)
+ ]
+ input[1] = false
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_stub_fai") {
+
+ options "-stub"
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ []
+ ]
+ input[1] = false
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_get_sizes") {
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ []
+ ]
+ input[1] = true
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_get_sizes_bgzip") {
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true),
+ []
+ ]
+ input[1] = true
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_get_sizes - stub") {
+
+ options "-stub"
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true),
+ []
+ ]
+ input[1] = true
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+ test("test_samtools_faidx_get_sizes_bgzip - stub") {
+
+ options "-stub"
+
+ when {
+ params {
+ module_args = ''
+ }
+ process {
+ """
+ input[0] = [
+ [ id:'test' ],
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true),
+ []
+ ]
+ input[1] = true
+ """
+ }
+ }
+
+ then {
+ assert process.success
+ assertAll(
+ { assert snapshot(sanitizeOutput(process.out)).match()}
+ )
+ }
+ }
+
+}
diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap
new file mode 100644
index 00000000..41697444
--- /dev/null
+++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap
@@ -0,0 +1,352 @@
+{
+ "test_samtools_faidx": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+ ]
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:39:12.541649151"
+ },
+ "test_samtools_faidx_get_sizes_bgzip - stub": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "gzi": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:41:44.040426987"
+ },
+ "test_samtools_faidx_get_sizes": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+ ]
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+ ]
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:47:03.653912015"
+ },
+ "test_samtools_faidx_bgzip": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+ ]
+ ],
+ "gzi": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474"
+ ]
+ ],
+ "sizes": [
+
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:50:04.023566795"
+ },
+ "test_samtools_faidx_fasta": {
+ "content": [
+ {
+ "fa": [
+ [
+ {
+ "id": "test"
+ },
+ "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36"
+ ]
+ ],
+ "fai": [
+
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:39:23.529404162"
+ },
+ "test_samtools_faidx_get_sizes - stub": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:41:39.039834304"
+ },
+ "test_samtools_faidx_stub_fasta": {
+ "content": [
+ {
+ "fa": [
+ [
+ {
+ "id": "test"
+ },
+ "extract.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "fai": [
+
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:39:28.961701609"
+ },
+ "test_samtools_faidx_stub_fai": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "gzi": [
+
+ ],
+ "sizes": [
+
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:39:34.471028474"
+ },
+ "test_samtools_faidx_get_sizes_bgzip": {
+ "content": [
+ {
+ "fa": [
+
+ ],
+ "fai": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5"
+ ]
+ ],
+ "gzi": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474"
+ ]
+ ],
+ "sizes": [
+ [
+ {
+ "id": "test"
+ },
+ "genome.fasta.gz.sizes:md5,a57c401f27ae5133823fb09fb21c8a3c"
+ ]
+ ],
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FAIDX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T15:39:45.439016495"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/trimgalore/tests/nextflow.config b/modules/nf-core/samtools/faidx/tests/nextflow.config
similarity index 62%
rename from modules/nf-core/trimgalore/tests/nextflow.config
rename to modules/nf-core/samtools/faidx/tests/nextflow.config
index d8e3ac13..202c036e 100644
--- a/modules/nf-core/trimgalore/tests/nextflow.config
+++ b/modules/nf-core/samtools/faidx/tests/nextflow.config
@@ -1,5 +1,7 @@
process {
- withName: TRIMGALORE {
+
+ withName: SAMTOOLS_FAIDX {
ext.args = params.module_args
}
+
}
diff --git a/modules/nf-core/samtools/fastq/environment.yml b/modules/nf-core/samtools/fastq/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/fastq/environment.yml
+++ b/modules/nf-core/samtools/fastq/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/fastq/main.nf b/modules/nf-core/samtools/fastq/main.nf
index 696d668f..922dbec3 100644
--- a/modules/nf-core/samtools/fastq/main.nf
+++ b/modules/nf-core/samtools/fastq/main.nf
@@ -4,8 +4,8 @@ process SAMTOOLS_FASTQ {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta), path(input)
@@ -16,7 +16,7 @@ process SAMTOOLS_FASTQ {
tuple val(meta), path("*_interleaved.fastq") , optional:true, emit: interleaved
tuple val(meta), path("*_singleton.fastq.gz") , optional:true, emit: singleton
tuple val(meta), path("*_other.fastq.gz") , optional:true, emit: other
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), emit: versions_samtools, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -28,6 +28,7 @@ process SAMTOOLS_FASTQ {
meta.single_end ? "-1 ${prefix}_1.fastq.gz -s ${prefix}_singleton.fastq.gz" :
"-1 ${prefix}_1.fastq.gz -2 ${prefix}_2.fastq.gz -s ${prefix}_singleton.fastq.gz"
"""
+ # Note: --threads value represents *additional* CPUs to allocate (total CPUs = 1 + --threads).
samtools \\
fastq \\
$args \\
@@ -35,11 +36,6 @@ process SAMTOOLS_FASTQ {
-0 ${prefix}_other.fastq.gz \\
$input \\
$output
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
@@ -50,10 +46,5 @@ process SAMTOOLS_FASTQ {
"""
${output}
echo | gzip > ${prefix}_other.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/samtools/fastq/meta.yml b/modules/nf-core/samtools/fastq/meta.yml
index c15a0b6f..cab17ffa 100644
--- a/modules/nf-core/samtools/fastq/meta.yml
+++ b/modules/nf-core/samtools/fastq/meta.yml
@@ -14,7 +14,8 @@ tools:
homepage: http://www.htslib.org/
documentation: http://www.htslib.org/doc/samtools.html
doi: 10.1093/bioinformatics/btp352
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:samtools
input:
- - meta:
@@ -26,34 +27,38 @@ input:
type: file
description: BAM/CRAM/SAM file
pattern: "*.{bam,cram,sam}"
- - - interleave:
- type: boolean
- description: Set true for interleaved fastq file
+ ontologies: []
+ - interleave:
+ type: boolean
+ description: Set true for interleaved fastq file
output:
- - fastq:
- - meta:
+ fastq:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*_{1,2}.fastq.gz":
type: file
- description: Compressed FASTQ file(s) with reads with either the READ1 or READ2
- flag set in separate files.
+ description: Compressed FASTQ file(s) with reads with either the READ1
+ or READ2 flag set in separate files.
pattern: "*_{1,2}.fastq.gz"
- - interleaved:
- - meta:
+ ontologies: []
+ interleaved:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*_interleaved.fastq":
type: file
- description: Compressed FASTQ file with reads with either the READ1 or READ2
- flag set in a combined file. Needs collated input file.
+ description: Compressed FASTQ file with reads with either the READ1 or
+ READ2 flag set in a combined file. Needs collated input file.
pattern: "*_interleaved.fastq.gz"
- - singleton:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989
+ singleton:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -62,22 +67,42 @@ output:
type: file
description: Compressed FASTQ file with singleton reads
pattern: "*_singleton.fastq.gz"
- - other:
- - meta:
+ ontologies:
+ - edam: http://edamontology.org/format_3989
+ other:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- "*_other.fastq.gz":
type: file
- description: Compressed FASTQ file with reads with either both READ1 and READ2
- flags set or unset
+ description: Compressed FASTQ file with reads with either both READ1 and
+ READ2 flags set or unset
pattern: "*_other.fastq.gz"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies:
+ - edam: http://edamontology.org/format_3989
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@priyanka-surana"
- "@suzannejin"
diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test b/modules/nf-core/samtools/fastq/tests/main.nf.test
index 971ea1d4..46ec7e7c 100644
--- a/modules/nf-core/samtools/fastq/tests/main.nf.test
+++ b/modules/nf-core/samtools/fastq/tests/main.nf.test
@@ -32,7 +32,7 @@ nextflow_process {
{ assert snapshot(process.out.interleaved).match("bam_interleaved") },
{ assert snapshot(file(process.out.singleton[0][1]).name).match("bam_singleton") },
{ assert snapshot(file(process.out.other[0][1]).name).match("bam_other") },
- { assert snapshot(process.out.versions).match("bam_versions") }
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith('versions') }).match("bam_versions") }
)
}
}
@@ -60,7 +60,7 @@ nextflow_process {
{ assert snapshot(path(process.out.interleaved[0][1]).readLines()[0..6]).match("bam_interlinterleave_eaved") },
{ assert snapshot(process.out.singleton).match("bam_singinterleave_leton") },
{ assert snapshot(file(process.out.other[0][1]).name).match("bam_interleave_other") },
- { assert snapshot(process.out.versions).match("bam_verinterleave_sions") }
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith('versions') }).match("bam_verinterleave_sions") }
)
}
}
@@ -86,7 +86,13 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.fastq,
+ process.out.interleaved,
+ process.out.singleton,
+ process.out.other,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -112,7 +118,13 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.fastq,
+ process.out.interleaved,
+ process.out.singleton,
+ process.out.other,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap
index ff63f9ae..17b5ade9 100644
--- a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap
@@ -29,86 +29,54 @@
},
"bam - stub": {
"content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
- ],
- "1": [
-
- ],
- "2": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test_singleton.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "3": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "4": [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
- ],
- "fastq": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
- ],
- "interleaved": [
-
- ],
- "other": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
[
- {
- "id": "test",
- "single_end": false
- },
- "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "test_1.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
+ "test_2.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
]
- ],
- "singleton": [
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_singleton.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
+ {
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test_singleton.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ "SAMTOOLS_FASTQ",
+ "samtools",
+ "1.22.1"
]
- ],
- "versions": [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-03-05T12:50:58.986886415"
+ "timestamp": "2026-02-02T17:05:55.514934"
},
"bam_fastq": {
"content": [
@@ -175,27 +143,39 @@
},
"bam_versions": {
"content": [
- [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
- ]
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FASTQ",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:00:41.44921616"
+ "timestamp": "2026-02-02T17:05:40.578464"
},
"bam_verinterleave_sions": {
"content": [
- [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
- ]
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FASTQ",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:00:56.47781168"
+ "timestamp": "2026-02-02T17:05:47.62481"
},
"bam_singleton": {
"content": [
@@ -221,67 +201,44 @@
},
"bam_interleave - stub": {
"content": [
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_interleaved.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
+ ]
+ ],
{
- "0": [
-
- ],
- "1": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test_interleaved.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_FASTQ",
+ "samtools",
+ "1.22.1"
]
- ],
- "2": [
-
- ],
- "3": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "4": [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
- ],
- "fastq": [
-
- ],
- "interleaved": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test_interleaved.fastq:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "other": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test_other.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "singleton": [
-
- ],
- "versions": [
- "versions.yml:md5,11e074d69900de5a7dfdbe1fb4e789fd"
]
}
],
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2025-03-05T12:51:10.155471004"
+ "timestamp": "2026-02-02T17:06:03.676263"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/flagstat/environment.yml b/modules/nf-core/samtools/flagstat/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/flagstat/environment.yml
+++ b/modules/nf-core/samtools/flagstat/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/flagstat/main.nf b/modules/nf-core/samtools/flagstat/main.nf
index c23f3a5c..0cfb7e87 100644
--- a/modules/nf-core/samtools/flagstat/main.nf
+++ b/modules/nf-core/samtools/flagstat/main.nf
@@ -4,15 +4,15 @@ process SAMTOOLS_FLAGSTAT {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta), path(bam), path(bai)
output:
tuple val(meta), path("*.flagstat"), emit: flagstat
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), emit: versions_samtools, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -25,21 +25,23 @@ process SAMTOOLS_FLAGSTAT {
--threads ${task.cpus} \\
$bam \\
> ${prefix}.flagstat
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
- touch ${prefix}.flagstat
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
+ cat <<-END_FLAGSTAT > ${prefix}.flagstat
+ 1000000 + 0 in total (QC-passed reads + QC-failed reads)
+ 0 + 0 secondary
+ 0 + 0 supplementary
+ 0 + 0 duplicates
+ 900000 + 0 mapped (90.00% : N/A)
+ 1000000 + 0 paired in sequencing
+ 500000 + 0 read1
+ 500000 + 0 read2
+ 800000 + 0 properly paired (80.00% : N/A)
+ 850000 + 0 with mate mapped to a different chr
+ 50000 + 0 with mate mapped to a different chr (mapQ>=5)
+ END_FLAGSTAT
"""
}
diff --git a/modules/nf-core/samtools/flagstat/meta.yml b/modules/nf-core/samtools/flagstat/meta.yml
index cdc4c254..8caa1bcc 100644
--- a/modules/nf-core/samtools/flagstat/meta.yml
+++ b/modules/nf-core/samtools/flagstat/meta.yml
@@ -1,6 +1,6 @@
name: samtools_flagstat
-description: Counts the number of alignments in a BAM/CRAM/SAM file for each FLAG
- type
+description: Counts the number of alignments in a BAM/CRAM/SAM file for each
+ FLAG type
keywords:
- stats
- mapping
@@ -17,7 +17,8 @@ tools:
homepage: http://www.htslib.org/
documentation: http://www.htslib.org/doc/samtools.html
doi: 10.1093/bioinformatics/btp352
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:samtools
input:
- - meta:
@@ -29,13 +30,15 @@ input:
type: file
description: BAM/CRAM/SAM file
pattern: "*.{bam,cram,sam}"
+ ontologies: []
- bai:
type: file
description: Index for BAM/CRAM/SAM file
pattern: "*.{bai,crai,sai}"
+ ontologies: []
output:
- - flagstat:
- - meta:
+ flagstat:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -44,11 +47,28 @@ output:
type: file
description: File containing samtools flagstat output
pattern: "*.{flagstat}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@drpatelh"
maintainers:
diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
index 04c3852b..f5c882da 100644
--- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap
@@ -8,11 +8,15 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"1": [
- "versions.yml:md5,108a155f2d4a99f50bf3176904208d27"
+ [
+ "SAMTOOLS_FLAGSTAT",
+ "samtools",
+ "1.22.1"
+ ]
],
"flagstat": [
[
@@ -20,19 +24,23 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
- "versions": [
- "versions.yml:md5,108a155f2d4a99f50bf3176904208d27"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FLAGSTAT",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:02:58.866491759"
+ "timestamp": "2026-02-03T11:14:30.820969684"
},
"BAM": {
"content": [
@@ -47,7 +55,11 @@
]
],
"1": [
- "versions.yml:md5,108a155f2d4a99f50bf3176904208d27"
+ [
+ "SAMTOOLS_FLAGSTAT",
+ "samtools",
+ "1.22.1"
+ ]
],
"flagstat": [
[
@@ -58,15 +70,19 @@
"test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783"
]
],
- "versions": [
- "versions.yml:md5,108a155f2d4a99f50bf3176904208d27"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_FLAGSTAT",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:02:47.383332837"
+ "timestamp": "2026-02-03T11:14:25.581619424"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/idxstats/environment.yml
+++ b/modules/nf-core/samtools/idxstats/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf
index e2bb6b20..d5b70a7f 100644
--- a/modules/nf-core/samtools/idxstats/main.nf
+++ b/modules/nf-core/samtools/idxstats/main.nf
@@ -4,15 +4,15 @@ process SAMTOOLS_IDXSTATS {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta), path(bam), path(bai)
output:
tuple val(meta), path("*.idxstats"), emit: idxstats
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), emit: versions_samtools, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -21,16 +21,12 @@ process SAMTOOLS_IDXSTATS {
def prefix = task.ext.prefix ?: "${meta.id}"
"""
+ # Note: --threads value represents *additional* CPUs to allocate (total CPUs = 1 + --threads).
samtools \\
idxstats \\
--threads ${task.cpus-1} \\
$bam \\
> ${prefix}.idxstats
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
@@ -38,10 +34,5 @@ process SAMTOOLS_IDXSTATS {
"""
touch ${prefix}.idxstats
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/samtools/idxstats/meta.yml b/modules/nf-core/samtools/idxstats/meta.yml
index f0a6bcb2..fd153841 100644
--- a/modules/nf-core/samtools/idxstats/meta.yml
+++ b/modules/nf-core/samtools/idxstats/meta.yml
@@ -17,7 +17,8 @@ tools:
homepage: http://www.htslib.org/
documentation: http://www.htslib.org/doc/samtools.html
doi: 10.1093/bioinformatics/btp352
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:samtools
input:
- - meta:
@@ -29,13 +30,15 @@ input:
type: file
description: BAM/CRAM/SAM file
pattern: "*.{bam,cram,sam}"
+ ontologies: []
- bai:
type: file
description: Index for BAM/CRAM/SAM file
pattern: "*.{bai,crai,sai}"
+ ontologies: []
output:
- - idxstats:
- - meta:
+ idxstats:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -44,11 +47,28 @@ output:
type: file
description: File containing samtools idxstats output
pattern: "*.{idxstats}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@drpatelh"
maintainers:
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test
index 5fd1fc78..c990cd55 100644
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test
@@ -25,7 +25,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.idxstats,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -47,7 +50,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.idxstats,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}}
diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
index 2cc89a3b..19a54c7c 100644
--- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap
@@ -1,72 +1,56 @@
{
"bam - stub": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
{
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "1": [
- "versions.yml:md5,c8d7394830c3c1e5be150589571534fb"
- ],
- "idxstats": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_IDXSTATS",
+ "samtools",
+ "1.22.1"
]
- ],
- "versions": [
- "versions.yml:md5,c8d7394830c3c1e5be150589571534fb"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:11:56.466856235"
+ "timestamp": "2026-02-02T16:21:46.333090477"
},
"bam": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ ]
+ ],
{
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
- ]
- ],
- "1": [
- "versions.yml:md5,c8d7394830c3c1e5be150589571534fb"
- ],
- "idxstats": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2"
+ "SAMTOOLS_IDXSTATS",
+ "samtools",
+ "1.22.1"
]
- ],
- "versions": [
- "versions.yml:md5,c8d7394830c3c1e5be150589571534fb"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:11:46.311550359"
+ "timestamp": "2026-02-02T16:21:41.063422521"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/index/environment.yml b/modules/nf-core/samtools/index/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/index/environment.yml
+++ b/modules/nf-core/samtools/index/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf
index 31175610..e2a0e56d 100644
--- a/modules/nf-core/samtools/index/main.nf
+++ b/modules/nf-core/samtools/index/main.nf
@@ -4,8 +4,8 @@ process SAMTOOLS_INDEX {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta), path(input)
@@ -14,7 +14,7 @@ process SAMTOOLS_INDEX {
tuple val(meta), path("*.bai") , optional:true, emit: bai
tuple val(meta), path("*.csi") , optional:true, emit: csi
tuple val(meta), path("*.crai"), optional:true, emit: crai
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), emit: versions_samtools, topic: versions
when:
task.ext.when == null || task.ext.when
@@ -24,14 +24,9 @@ process SAMTOOLS_INDEX {
"""
samtools \\
index \\
- -@ ${task.cpus-1} \\
+ -@ ${task.cpus} \\
$args \\
$input
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
@@ -40,10 +35,5 @@ process SAMTOOLS_INDEX {
"crai" : args.contains("-c") ? "csi" : "bai"
"""
touch ${input}.${extension}
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/samtools/index/meta.yml b/modules/nf-core/samtools/index/meta.yml
index db8df0d5..c6d4ce25 100644
--- a/modules/nf-core/samtools/index/meta.yml
+++ b/modules/nf-core/samtools/index/meta.yml
@@ -14,7 +14,8 @@ tools:
homepage: http://www.htslib.org/
documentation: http://www.htslib.org/doc/samtools.html
doi: 10.1093/bioinformatics/btp352
- licence: ["MIT"]
+ licence:
+ - "MIT"
identifier: biotools:samtools
input:
- - meta:
@@ -25,9 +26,10 @@ input:
- input:
type: file
description: input file
+ ontologies: []
output:
- - bai:
- - meta:
+ bai:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -36,8 +38,9 @@ output:
type: file
description: BAM/CRAM/SAM index file
pattern: "*.{bai,crai,sai}"
- - csi:
- - meta:
+ ontologies: []
+ csi:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -46,8 +49,9 @@ output:
type: file
description: CSI index file
pattern: "*.{csi}"
- - crai:
- - meta:
+ ontologies: []
+ crai:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -56,11 +60,28 @@ output:
type: file
description: BAM/CRAM/SAM index file
pattern: "*.{bai,crai,sai}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - samtools:
+ type: string
+ description: The name of the tool
+ - samtools version | sed '1!d;s/.* //':
+ type: eval
+ description: The expression to obtain the version of the tool
authors:
- "@drpatelh"
- "@ewels"
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test
index ca34fb5c..c96cec86 100644
--- a/modules/nf-core/samtools/index/tests/main.nf.test
+++ b/modules/nf-core/samtools/index/tests/main.nf.test
@@ -23,7 +23,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.bai,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -43,7 +46,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.crai,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -67,7 +73,7 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
file(process.out.csi[0][1]).name,
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith('versions') }
).match() }
)
}
@@ -89,7 +95,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.bai,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -110,7 +119,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.crai,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
@@ -133,7 +145,10 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(
+ process.out.csi,
+ process.out.findAll { key, val -> key.startsWith('versions') }
+ ).match() }
)
}
}
diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap
index 72d65e81..afc8a1ff 100644
--- a/modules/nf-core/samtools/index/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap
@@ -1,250 +1,156 @@
{
"csi - stub": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
{
- "0": [
-
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
-
- ],
- "3": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ],
- "bai": [
-
- ],
- "crai": [
-
- ],
- "csi": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
]
- ],
- "versions": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:21:25.261127166"
+ "timestamp": "2026-01-28T17:52:10.030187"
},
"crai - stub": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
{
- "0": [
-
- ],
- "1": [
-
- ],
- "2": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
]
- ],
- "3": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ],
- "bai": [
-
- ],
- "crai": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:21:12.653194876"
+ "timestamp": "2026-01-28T17:51:59.125484"
},
"bai - stub": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
{
- "0": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
]
- ],
- "1": [
-
- ],
- "2": [
-
- ],
- "3": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ],
- "bai": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "crai": [
-
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:21:01.854932651"
+ "timestamp": "2026-01-28T17:51:47.277042"
},
"csi": {
"content": [
"test.paired_end.sorted.bam.csi",
- [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ]
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:20:51.485364222"
+ "timestamp": "2026-01-28T17:51:35.758735"
},
"crai": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+ ]
+ ],
{
- "0": [
-
- ],
- "1": [
-
- ],
- "2": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
]
- ],
- "3": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ],
- "bai": [
-
- ],
- "crai": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029"
- ]
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:20:40.518873972"
+ "timestamp": "2026-01-28T17:51:26.561965"
},
"bai": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
+ ]
+ ],
{
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
- ]
- ],
- "1": [
-
- ],
- "2": [
-
- ],
- "3": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
- ],
- "bai": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4"
+ "SAMTOOLS_INDEX",
+ "samtools",
+ "1.22.1"
]
- ],
- "crai": [
-
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,5e09a6fdf76de396728f877193d72315"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.2"
},
- "timestamp": "2024-09-16T08:20:21.184050361"
+ "timestamp": "2026-01-28T17:51:15.299035"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/sort/environment.yml
+++ b/modules/nf-core/samtools/sort/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf
index caf3c61a..6b5aa31d 100644
--- a/modules/nf-core/samtools/sort/main.nf
+++ b/modules/nf-core/samtools/sort/main.nf
@@ -4,30 +4,41 @@ process SAMTOOLS_SORT {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta) , path(bam)
tuple val(meta2), path(fasta)
+ val index_format
output:
- tuple val(meta), path("*.bam"), emit: bam, optional: true
- tuple val(meta), path("*.cram"), emit: cram, optional: true
- tuple val(meta), path("*.crai"), emit: crai, optional: true
- tuple val(meta), path("*.csi"), emit: csi, optional: true
- path "versions.yml", emit: versions
+ tuple val(meta), path("${prefix}.bam"), emit: bam, optional: true
+ tuple val(meta), path("${prefix}.cram"), emit: cram, optional: true
+ tuple val(meta), path("${prefix}.sam"), emit: sam, optional: true
+ tuple val(meta), path("${prefix}.${extension}.crai"), emit: crai, optional: true
+ tuple val(meta), path("${prefix}.${extension}.csi"), emit: csi, optional: true
+ tuple val(meta), path("${prefix}.${extension}.bai"), emit: bai, optional: true
+ tuple val("${task.process}"), val('samtools'), eval("samtools version | sed '1!d;s/.* //'"), topic: versions, emit: versions_samtools
when:
task.ext.when == null || task.ext.when
script:
def args = task.ext.args ?: ''
- def prefix = task.ext.prefix ?: "${meta.id}"
- def extension = args.contains("--output-fmt sam") ? "sam" :
- args.contains("--output-fmt cram") ? "cram" :
- "bam"
+ prefix = task.ext.prefix ?: "${meta.id}"
+ extension = args.contains("--output-fmt sam") ? "sam" :
+ args.contains("--output-fmt cram") ? "cram" :
+ "bam"
def reference = fasta ? "--reference ${fasta}" : ""
+ output_file = index_format ? "${prefix}.${extension}##idx##${prefix}.${extension}.${index_format} --write-index" : "${prefix}.${extension}"
+ if (index_format) {
+ if (!index_format.matches('bai|csi|crai')) {
+ error "Index format not one of bai, csi, crai."
+ } else if (extension == "sam") {
+ error "Indexing not compatible with SAM output"
+ }
+ }
if ("$bam" == "${prefix}.bam") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!"
"""
@@ -39,34 +50,29 @@ process SAMTOOLS_SORT {
-T ${prefix} \\
--threads $task.cpus \\
${reference} \\
- -o ${prefix}.${extension} \\
+ -o ${output_file} \\
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
def args = task.ext.args ?: ''
- def prefix = task.ext.prefix ?: "${meta.id}"
- def extension = args.contains("--output-fmt sam") ? "sam" :
- args.contains("--output-fmt cram") ? "cram" :
- "bam"
+ prefix = task.ext.prefix ?: "${meta.id}"
+ extension = args.contains("--output-fmt sam") ? "sam" :
+ args.contains("--output-fmt cram") ? "cram" :
+ "bam"
+ if (index_format) {
+ if (!index_format.matches('bai|csi|crai')) {
+ error "Index format not one of bai, csi, crai."
+ } else if (extension == "sam") {
+ error "Indexing not compatible with SAM output"
+ }
+ }
+ index = index_format ? "touch ${prefix}.${extension}.${index_format}" : ""
+
"""
touch ${prefix}.${extension}
- if [ "${extension}" == "bam" ];
- then
- touch ${prefix}.${extension}.csi
- elif [ "${extension}" == "cram" ];
- then
- touch ${prefix}.${extension}.crai
- fi
+ ${index}
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/samtools/sort/meta.yml b/modules/nf-core/samtools/sort/meta.yml
index a9dbec5a..69968304 100644
--- a/modules/nf-core/samtools/sort/meta.yml
+++ b/modules/nf-core/samtools/sort/meta.yml
@@ -26,6 +26,7 @@ input:
type: file
description: BAM/CRAM/SAM file(s)
pattern: "*.{bam,cram,sam}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -36,52 +37,101 @@ input:
description: Reference genome FASTA file
pattern: "*.{fa,fasta,fna}"
optional: true
+ ontologies: []
+ - index_format:
+ type: string
+ description: Index format to use (optional)
+ pattern: "bai|csi|crai"
output:
- - bam:
- - meta:
+ bam:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- - "*.bam":
+ - "${prefix}.bam":
type: file
description: Sorted BAM file
pattern: "*.{bam}"
- - cram:
- - meta:
+ ontologies: []
+ cram:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- - "*.cram":
+ - "${prefix}.cram":
type: file
description: Sorted CRAM file
pattern: "*.{cram}"
- - crai:
- - meta:
+ ontologies: []
+ sam:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- - "*.crai":
+ - "${prefix}.sam":
+ type: file
+ description: Sorted SAM file
+ pattern: "*.{sam}"
+ ontologies: []
+ crai:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "${prefix}.${extension}.crai":
type: file
description: CRAM index file (optional)
pattern: "*.crai"
- - csi:
- - meta:
+ ontologies: []
+ csi:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
e.g. [ id:'test', single_end:false ]
- - "*.csi":
+ - "${prefix}.${extension}.csi":
type: file
description: BAM index file (optional)
pattern: "*.csi"
- - versions:
- - versions.yml:
+ ontologies: []
+ bai:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test', single_end:false ]
+ - "${prefix}.${extension}.bai":
type: file
- description: File containing software versions
- pattern: "versions.yml"
+ description: BAM index file (optional)
+ pattern: "*.bai"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - samtools:
+ type: string
+ description: The tool name
+ - "samtools version | sed '1!d;s/.* //'":
+ type: string
+ description: The command used to generate the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The process the versions were collected from
+ - samtools:
+ type: string
+ description: The tool name
+ - "samtools version | sed '1!d;s/.* //'":
+ type: string
+ description: The command used to generate the version of the tool
+
authors:
- "@drpatelh"
- "@ewels"
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test
index b05e6691..df47bb25 100644
--- a/modules/nf-core/samtools/sort/tests/main.nf.test
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test
@@ -8,7 +8,7 @@ nextflow_process {
tag "samtools"
tag "samtools/sort"
- test("bam") {
+ test("bam_no_index") {
config "./nextflow.config"
@@ -23,6 +23,7 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
"""
}
}
@@ -32,8 +33,72 @@ nextflow_process {
{ assert process.success },
{ assert snapshot(
process.out.bam,
- process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } },
- process.out.versions
+ process.out.bai,
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()}
+ )
+ }
+ }
+
+ test("bam_bai_index") {
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'fasta' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = 'bai'
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ process.out.bam,
+ process.out.bai,
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()}
+ )
+ }
+ }
+
+ test("bam_csi_index") {
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true)
+ ])
+ input[1] = Channel.of([
+ [ id:'fasta' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = 'csi'
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ process.out.bam,
+ process.out.csi,
+ process.out.findAll { key, val -> key.startsWith("versions") }
).match()}
)
}
@@ -57,6 +122,77 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ process.out.bam,
+ process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } },
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()}
+ )
+ }
+ }
+
+ test("multiple bam bai index") {
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true)
+ ]
+ ])
+ input[1] = Channel.of([
+ [ id:'fasta' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = 'bai'
+ """
+ }
+ }
+
+ then {
+ assertAll (
+ { assert process.success },
+ { assert snapshot(
+ process.out.bam,
+ process.out.bai.collect { it.collect { it instanceof Map ? it : file(it).name } },
+ process.out.findAll { key, val -> key.startsWith("versions") }
+ ).match()}
+ )
+ }
+ }
+
+ test("multiple bam csi index") {
+
+ config "./nextflow.config"
+
+ when {
+ process {
+ """
+ input[0] = Channel.of([
+ [ id:'test', single_end:false ], // meta map
+ [
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test2.paired_end.sorted.bam', checkIfExists: true)
+ ]
+ ])
+ input[1] = Channel.of([
+ [ id:'fasta' ], // meta map
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
+ ])
+ input[2] = 'csi'
"""
}
}
@@ -67,7 +203,7 @@ nextflow_process {
{ assert snapshot(
process.out.bam,
process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } },
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions") }
).match()}
)
}
@@ -88,6 +224,7 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
"""
}
}
@@ -98,7 +235,7 @@ nextflow_process {
{ assert snapshot(
process.out.cram.collect { it.collect { it instanceof Map ? it : file(it).name } },
process.out.crai.collect { it.collect { it instanceof Map ? it : file(it).name } },
- process.out.versions
+ process.out.findAll { key, val -> key.startsWith("versions") }
).match()}
)
}
@@ -120,6 +257,7 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
"""
}
}
@@ -127,7 +265,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith("versions") }).match() }
)
}
}
@@ -150,6 +288,7 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
"""
}
}
@@ -157,7 +296,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith("versions") }).match() }
)
}
}
@@ -178,6 +317,7 @@ nextflow_process {
[ id:'fasta' ], // meta map
file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true)
])
+ input[2] = ''
"""
}
}
@@ -185,7 +325,7 @@ nextflow_process {
then {
assertAll (
{ assert process.success },
- { assert snapshot(process.out).match() }
+ { assert snapshot(process.out.findAll { key, val -> key.startsWith("versions") }).match() }
)
}
}
diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
index 469891fe..4e618fa3 100644
--- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap
@@ -19,147 +19,77 @@
"test.sorted.cram.crai"
]
],
- [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ]
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T08:49:58.207549273"
+ "timestamp": "2025-10-29T12:47:01.171084"
},
- "bam - stub": {
+ "bam_csi_index": {
"content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,72ca1dff5344a5e5e6b892fe5f6b134d"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.csi:md5,01394e702c729cb478df914ffaf9f7f8"
+ ]
+ ],
{
- "0": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "1": [
-
- ],
- "2": [
-
- ],
- "3": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "4": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ],
- "bam": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "crai": [
-
- ],
- "cram": [
-
- ],
- "csi": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "versions": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T08:50:08.630951018"
+ "timestamp": "2025-10-29T12:46:00.961675"
},
- "cram - stub": {
+ "bam - stub": {
"content": [
{
- "0": [
-
- ],
- "1": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "2": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "3": [
-
- ],
- "4": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ],
- "bam": [
-
- ],
- "crai": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "cram": [
- [
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "csi": [
-
- ],
- "versions": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T08:50:19.061912443"
+ "timestamp": "2025-10-29T12:47:12.154354"
},
- "multiple bam": {
+ "multiple bam bai index": {
"content": [
[
[
@@ -167,7 +97,7 @@
"id": "test",
"single_end": false
},
- "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12"
+ "test.sorted.bam:md5,3ffa2affc29f0aa6e7b36dded84625fe"
]
],
[
@@ -176,85 +106,122 @@
"id": "test",
"single_end": false
},
- "test.sorted.bam.csi"
+ "test.sorted.bam.bai"
]
],
- [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ]
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.09.0"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-10-08T11:59:55.479443"
+ "timestamp": "2025-10-29T12:46:25.488622"
},
- "multiple bam - stub": {
+ "cram - stub": {
"content": [
{
- "0": [
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "1": [
-
- ],
- "2": [
-
- ],
- "3": [
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
+ },
+ "timestamp": "2025-10-29T12:47:28.485045"
+ },
+ "multiple bam": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,cd4eb0077f25e9cff395366b8883dd1f"
+ ]
+ ],
+ [
+
+ ],
+ {
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "4": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ],
- "bam": [
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
+ },
+ "timestamp": "2025-10-29T12:46:13.168476"
+ },
+ "multiple bam - stub": {
+ "content": [
+ {
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam:md5,8a16ba90c7d294cbb4c33ac0f7127a12"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "crai": [
-
- ],
- "cram": [
-
- ],
- "csi": [
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
+ },
+ "timestamp": "2025-10-29T12:47:21.628088"
+ },
+ "bam_no_index": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,26b27d1f9bcb61c25da21b562349784e"
+ ]
+ ],
+ [
+
+ ],
+ {
+ "versions_samtools": [
[
- {
- "id": "test",
- "single_end": false
- },
- "test.sorted.bam.csi:md5,d185916eaff9afeb4d0aeab3310371f9"
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
]
- ],
- "versions": [
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.09.0"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-10-08T11:36:13.781404"
+ "timestamp": "2025-10-29T12:45:47.139418"
},
- "bam": {
+ "multiple bam csi index": {
"content": [
[
[
@@ -262,7 +229,7 @@
"id": "test",
"single_end": false
},
- "test.sorted.bam:md5,34aa85e86abefe637f7a4a9887f016fc"
+ "test.sorted.bam:md5,295503ba5342531a3310c33ad0efbc22"
]
],
[
@@ -274,14 +241,56 @@
"test.sorted.bam.csi"
]
],
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
+ },
+ "timestamp": "2025-10-29T12:46:51.5531"
+ },
+ "bam_bai_index": {
+ "content": [
+ [
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam:md5,cae7564cb83bb4a5911205bf94124b54"
+ ]
+ ],
[
- "versions.yml:md5,2659b187d681241451539d4c53500b9f"
- ]
+ [
+ {
+ "id": "test",
+ "single_end": false
+ },
+ "test.sorted.bam.bai:md5,50dd467c169545a4d5d1f709f7e986e0"
+ ]
+ ],
+ {
+ "versions_samtools": [
+ [
+ "SAMTOOLS_SORT",
+ "samtools",
+ "1.22.1"
+ ]
+ ]
+ }
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.09.0"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-10-08T11:59:46.372244"
+ "timestamp": "2025-10-29T12:45:52.796936"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/samtools/sort/tests/nextflow.config b/modules/nf-core/samtools/sort/tests/nextflow.config
index f642771f..723f62b2 100644
--- a/modules/nf-core/samtools/sort/tests/nextflow.config
+++ b/modules/nf-core/samtools/sort/tests/nextflow.config
@@ -2,7 +2,6 @@ process {
withName: SAMTOOLS_SORT {
ext.prefix = { "${meta.id}.sorted" }
- ext.args = "--write-index"
}
}
diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml
index 62054fc9..89e12a64 100644
--- a/modules/nf-core/samtools/stats/environment.yml
+++ b/modules/nf-core/samtools/stats/environment.yml
@@ -4,5 +4,7 @@ channels:
- conda-forge
- bioconda
dependencies:
- - bioconda::htslib=1.21
- - bioconda::samtools=1.21
+ # renovate: datasource=conda depName=bioconda/htslib
+ - bioconda::htslib=1.22.1
+ # renovate: datasource=conda depName=bioconda/samtools
+ - bioconda::samtools=1.22.1
diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf
index 4443948b..57d24680 100644
--- a/modules/nf-core/samtools/stats/main.nf
+++ b/modules/nf-core/samtools/stats/main.nf
@@ -4,8 +4,8 @@ process SAMTOOLS_STATS {
conda "${moduleDir}/environment.yml"
container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
- 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' :
- 'biocontainers/samtools:1.21--h50ea8bc_0' }"
+ 'https://depot.galaxyproject.org/singularity/samtools:1.22.1--h96c455f_0' :
+ 'biocontainers/samtools:1.22.1--h96c455f_0' }"
input:
tuple val(meta), path(input), path(input_index)
@@ -13,36 +13,28 @@ process SAMTOOLS_STATS {
output:
tuple val(meta), path("*.stats"), emit: stats
- path "versions.yml" , emit: versions
+ tuple val("${task.process}"), val('samtools'), eval('samtools version | sed "1!d;s/.* //"'), emit: versions_samtools, topic: versions
when:
task.ext.when == null || task.ext.when
script:
- def prefix = task.ext.prefix ?: "${meta.id}"
+ def args = task.ext.args ?: ''
+ def prefix = task.ext.prefix ?: "${meta.id}"
def reference = fasta ? "--reference ${fasta}" : ""
"""
samtools \\
stats \\
+ ${args} \\
--threads ${task.cpus} \\
${reference} \\
${input} \\
> ${prefix}.stats
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
stub:
def prefix = task.ext.prefix ?: "${meta.id}"
"""
touch ${prefix}.stats
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//')
- END_VERSIONS
"""
}
diff --git a/modules/nf-core/samtools/stats/meta.yml b/modules/nf-core/samtools/stats/meta.yml
index 77b020f7..5c59cce4 100644
--- a/modules/nf-core/samtools/stats/meta.yml
+++ b/modules/nf-core/samtools/stats/meta.yml
@@ -27,10 +27,12 @@ input:
type: file
description: BAM/CRAM file from alignment
pattern: "*.{bam,cram}"
+ ontologies: []
- input_index:
type: file
description: BAI/CRAI file from alignment
pattern: "*.{bai,crai}"
+ ontologies: []
- - meta2:
type: map
description: |
@@ -40,9 +42,10 @@ input:
type: file
description: Reference file the CRAM was created with (optional)
pattern: "*.{fasta,fa}"
+ ontologies: []
output:
- - stats:
- - meta:
+ stats:
+ - - meta:
type: map
description: |
Groovy Map containing sample information
@@ -51,11 +54,30 @@ output:
type: file
description: File containing samtools stats output
pattern: "*.{stats}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
+ ontologies: []
+ versions_samtools:
+ - - ${task.process}:
+ type: string
+ description: Name of the process
+ - samtools:
+ type: string
+ description: Name of the tool
+ - samtools version | sed "1!d;s/.* //":
+ type: eval
+ description: The expression to obtain the version of the tool
+
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: Name of the process
+ - samtools:
+ type: string
+ description: Name of the tool
+ - samtools version | sed "1!d;s/.* //":
+ type: eval
+ description: The expression to obtain the version of the tool
+
authors:
- "@drpatelh"
- "@FriederikeHanssen"
diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
index df507be7..94d981b2 100644
--- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap
+++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap
@@ -8,11 +8,15 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,a27fe55e49a341f92379bb20a65c6a06"
+ "test.stats:md5,f4aec6c41b73d34ac2fc6b3253aa39ba"
]
],
"1": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
],
"stats": [
[
@@ -20,19 +24,23 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,a27fe55e49a341f92379bb20a65c6a06"
+ "test.stats:md5,f4aec6c41b73d34ac2fc6b3253aa39ba"
]
],
- "versions": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T09:29:16.767396182"
+ "timestamp": "2025-11-01T02:27:18.460724"
},
"bam - stub": {
"content": [
@@ -47,7 +55,11 @@
]
],
"1": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
],
"stats": [
[
@@ -58,16 +70,20 @@
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T09:29:29.721580274"
+ "timestamp": "2025-11-01T02:27:30.245839"
},
"cram - stub": {
"content": [
@@ -82,7 +98,11 @@
]
],
"1": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
],
"stats": [
[
@@ -93,16 +113,20 @@
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "versions": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T09:29:53.567964304"
+ "timestamp": "2025-11-01T02:27:39.041649"
},
"bam": {
"content": [
@@ -113,11 +137,15 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,d53a2584376d78942839e9933a34d11b"
+ "test.stats:md5,41ba8ad30ddb598dadb177a54c222ab9"
]
],
"1": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
],
"stats": [
[
@@ -125,18 +153,22 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,d53a2584376d78942839e9933a34d11b"
+ "test.stats:md5,41ba8ad30ddb598dadb177a54c222ab9"
]
],
- "versions": [
- "versions.yml:md5,15b91d8c0e0440332e0fe4df80957043"
+ "versions_samtools": [
+ [
+ "SAMTOOLS_STATS",
+ "samtools",
+ "1.22.1"
+ ]
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.0"
},
- "timestamp": "2024-09-16T09:28:50.73610604"
+ "timestamp": "2025-11-01T02:26:55.988241"
}
}
\ No newline at end of file
diff --git a/modules/nf-core/trimgalore/environment.yml b/modules/nf-core/trimgalore/environment.yml
deleted file mode 100644
index 568b9e72..00000000
--- a/modules/nf-core/trimgalore/environment.yml
+++ /dev/null
@@ -1,9 +0,0 @@
----
-# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json
-channels:
- - conda-forge
- - bioconda
-dependencies:
- - bioconda::cutadapt=4.9
- - bioconda::trim-galore=0.6.10
- - conda-forge::pigz=2.8
diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf
deleted file mode 100644
index 5fe53669..00000000
--- a/modules/nf-core/trimgalore/main.nf
+++ /dev/null
@@ -1,107 +0,0 @@
-process TRIMGALORE {
- tag "${meta.id}"
- label 'process_high'
-
- conda "${moduleDir}/environment.yml"
- container "${workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container
- ? 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/9b/9becad054093ad4083a961d12733f2a742e11728fe9aa815d678b882b3ede520/data'
- : 'community.wave.seqera.io/library/cutadapt_trim-galore_pigz:a98edd405b34582d'}"
-
- input:
- tuple val(meta), path(reads)
-
- output:
- tuple val(meta), path("*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz"), emit: reads
- tuple val(meta), path("*report.txt") , emit: log, optional: true
- tuple val(meta), path("*unpaired{,_1,_2}.fq.gz") , emit: unpaired, optional: true
- tuple val(meta), path("*.html") , emit: html, optional: true
- tuple val(meta), path("*.zip") , emit: zip, optional: true
- path "versions.yml" , emit: versions
-
- when:
- task.ext.when == null || task.ext.when
-
- script:
- def args = task.ext.args ?: ''
- // Calculate number of --cores for TrimGalore based on value of task.cpus
- // See: https://github.com/FelixKrueger/TrimGalore/blob/master/CHANGELOG.md#version-060-release-on-1-mar-2019
- // See: https://github.com/nf-core/atacseq/pull/65
- def cores = 1
- if (task.cpus) {
- cores = (task.cpus as int) - 4
- if (meta.single_end) {
- cores = (task.cpus as int) - 3
- }
- if (cores < 1) {
- cores = 1
- }
- if (cores > 8) {
- cores = 8
- }
- }
-
- // Added soft-links to original fastqs for consistent naming in MultiQC
- def prefix = task.ext.prefix ?: "${meta.id}"
- if (meta.single_end) {
- def args_list = args.split("\\s(?=--)").toList()
- args_list.removeAll { it.toLowerCase().contains('_r2 ') }
- """
- [ ! -f ${prefix}.fastq.gz ] && ln -s ${reads} ${prefix}.fastq.gz
- trim_galore \\
- ${args_list.join(' ')} \\
- --cores ${cores} \\
- --gzip \\
- ${prefix}.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//')
- cutadapt: \$(cutadapt --version)
- pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
- END_VERSIONS
- """
- }
- else {
- """
- [ ! -f ${prefix}_1.fastq.gz ] && ln -s ${reads[0]} ${prefix}_1.fastq.gz
- [ ! -f ${prefix}_2.fastq.gz ] && ln -s ${reads[1]} ${prefix}_2.fastq.gz
- trim_galore \\
- ${args} \\
- --cores ${cores} \\
- --paired \\
- --gzip \\
- ${prefix}_1.fastq.gz \\
- ${prefix}_2.fastq.gz
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//')
- cutadapt: \$(cutadapt --version)
- pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
- END_VERSIONS
- """
- }
-
- stub:
- def prefix = task.ext.prefix ?: "${meta.id}"
- if (meta.single_end) {
- output_command = "echo '' | gzip > ${prefix}_trimmed.fq.gz ;"
- output_command += "touch ${prefix}.fastq.gz_trimming_report.txt"
- }
- else {
- output_command = "echo '' | gzip > ${prefix}_1_trimmed.fq.gz ;"
- output_command += "touch ${prefix}_1.fastq.gz_trimming_report.txt ;"
- output_command += "echo '' | gzip > ${prefix}_2_trimmed.fq.gz ;"
- output_command += "touch ${prefix}_2.fastq.gz_trimming_report.txt"
- }
- """
- ${output_command}
-
- cat <<-END_VERSIONS > versions.yml
- "${task.process}":
- trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//')
- cutadapt: \$(cutadapt --version)
- pigz: \$( pigz --version 2>&1 | sed 's/pigz //g' )
- END_VERSIONS
- """
-}
diff --git a/modules/nf-core/trimgalore/meta.yml b/modules/nf-core/trimgalore/meta.yml
deleted file mode 100644
index bd793635..00000000
--- a/modules/nf-core/trimgalore/meta.yml
+++ /dev/null
@@ -1,105 +0,0 @@
-name: trimgalore
-description: Trim FastQ files using Trim Galore!
-keywords:
- - trimming
- - adapters
- - sequencing adapters
- - fastq
-tools:
- - trimgalore:
- description: |
- A wrapper tool around Cutadapt and FastQC to consistently apply quality
- and adapter trimming to FastQ files, with some extra functionality for
- MspI-digested RRBS-type (Reduced Representation Bisufite-Seq) libraries.
- homepage: https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/
- documentation: https://github.com/FelixKrueger/TrimGalore/blob/master/Docs/Trim_Galore_User_Guide.md
- licence: ["GPL-3.0-or-later"]
- identifier: ""
-input:
- - - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - reads:
- type: file
- description: |
- List of input FastQ files of size 1 and 2 for single-end and paired-end data,
- respectively.
-output:
- - reads:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz":
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*{3prime,5prime,trimmed,val}{,_1,_2}.fq.gz"
- - log:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{report.txt}"
- - "*report.txt":
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{report.txt}"
- - unpaired:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- - "*unpaired{,_1,_2}.fq.gz":
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*unpaired*.fq.gz"
- - html:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{fastqc.html}"
- - "*.html":
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{fastqc.html}"
- - zip:
- - meta:
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{fastqc.zip}"
- - "*.zip":
- type: map
- description: |
- Groovy Map containing sample information
- e.g. [ id:'test', single_end:false ]
- pattern: "*_{fastqc.zip}"
- - versions:
- - versions.yml:
- type: file
- description: File containing software versions
- pattern: "versions.yml"
-authors:
- - "@drpatelh"
- - "@ewels"
- - "@FelixKrueger"
-maintainers:
- - "@drpatelh"
- - "@ewels"
- - "@FelixKrueger"
diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test
deleted file mode 100644
index c01672c4..00000000
--- a/modules/nf-core/trimgalore/tests/main.nf.test
+++ /dev/null
@@ -1,188 +0,0 @@
-nextflow_process {
-
- name "Test Process TRIMGALORE"
- script "../main.nf"
- process "TRIMGALORE"
- tag "modules"
- tag "modules_nfcore"
- tag "trimgalore"
-
- test("test_trimgalore_single_end") {
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ]
- ]
- """
- }
- }
-
- then {
- def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) }
- }
- },
- { report1_lines.each { report1_line ->
- { assert path(process.out.log.get(0).get(1)).getText().contains(report1_line) }
- }
- },
- { assert snapshot(path(process.out.versions.get(0)).yaml).match() },
- )
- }
- }
-
- test("test_trimgalore_single_end - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end:true ], // meta map
- [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ]
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(
- process.out,
- path(process.out.versions.get(0)).yaml
- ).match() },
- )
- }
- }
-
- test("test_trimgalore_paired_end") {
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
- ]
- ]
- """
- }
- }
-
- then {
- def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1",
- "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT",
- "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE
- { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) }
- }
- },
- { read2_lines.each { read2_line ->
- { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) }
- }
- },
- { report1_lines.each { report1_line ->
- { assert path(process.out.log.get(0).get(1).get(0)).getText().contains(report1_line) }
- }
- },
- { report2_lines.each { report2_line ->
- { assert path(process.out.log.get(0).get(1).get(1)).getText().contains(report2_line) }
- }
- },
- { assert snapshot(path(process.out.versions.get(0)).yaml).match() },
- )
- }
- }
-
- test("test_trimgalore_paired_end_keep_unpaired") {
-
- config "./nextflow.config"
-
- when {
-
- params {
- module_args = '--retain_unpaired --length 150'
- }
-
- process {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
- ]
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(
- path(process.out.versions.get(0)).yaml,
- process.out.reads,
- process.out.unpaired
- ).match() },
- )
- }
- }
-
- test("test_trimgalore_paired_end - stub") {
-
- options "-stub"
-
- when {
- process {
- """
- input[0] = [ [ id:'test', single_end:false ], // meta map
- [
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true),
- file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true)
- ]
- ]
- """
- }
- }
-
- then {
- assertAll(
- { assert process.success },
- { assert snapshot(process.out).match() },
- { assert snapshot(path(process.out.versions.get(0)).yaml).match("versions") },
- )
- }
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap
deleted file mode 100644
index c454ad52..00000000
--- a/modules/nf-core/trimgalore/tests/main.nf.test.snap
+++ /dev/null
@@ -1,251 +0,0 @@
-{
- "test_trimgalore_single_end": {
- "content": [
- {
- "TRIMGALORE": {
- "trimgalore": "0.6.10",
- "cutadapt": 4.9,
- "pigz": 2.8
- }
- }
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:25:01.330769598"
- },
- "test_trimgalore_single_end - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "2": [
-
- ],
- "3": [
-
- ],
- "4": [
-
- ],
- "5": [
- "versions.yml:md5,5928323d579768de37e83c56c821757f"
- ],
- "html": [
-
- ],
- "log": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ],
- "reads": [
- [
- {
- "id": "test",
- "single_end": true
- },
- "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ],
- "unpaired": [
-
- ],
- "versions": [
- "versions.yml:md5,5928323d579768de37e83c56c821757f"
- ],
- "zip": [
-
- ]
- },
- {
- "TRIMGALORE": {
- "trimgalore": "0.6.10",
- "cutadapt": 4.9,
- "pigz": 2.8
- }
- }
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:25:15.582246999"
- },
- "test_trimgalore_paired_end - stub": {
- "content": [
- {
- "0": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
- ],
- "1": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
- "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- ],
- "2": [
-
- ],
- "3": [
-
- ],
- "4": [
-
- ],
- "5": [
- "versions.yml:md5,5928323d579768de37e83c56c821757f"
- ],
- "html": [
-
- ],
- "log": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
- "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e"
- ]
- ]
- ],
- "reads": [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940",
- "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940"
- ]
- ]
- ],
- "unpaired": [
-
- ],
- "versions": [
- "versions.yml:md5,5928323d579768de37e83c56c821757f"
- ],
- "zip": [
-
- ]
- }
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:26:05.201562315"
- },
- "versions": {
- "content": [
- {
- "TRIMGALORE": {
- "trimgalore": "0.6.10",
- "cutadapt": 4.9,
- "pigz": 2.8
- }
- }
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:26:05.229598492"
- },
- "test_trimgalore_paired_end": {
- "content": [
- {
- "TRIMGALORE": {
- "trimgalore": "0.6.10",
- "cutadapt": 4.9,
- "pigz": 2.8
- }
- }
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:25:33.510924538"
- },
- "test_trimgalore_paired_end_keep_unpaired": {
- "content": [
- {
- "TRIMGALORE": {
- "trimgalore": "0.6.10",
- "cutadapt": 4.9,
- "pigz": 2.8
- }
- },
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_val_1.fq.gz:md5,75413e85910bbc2e1556e12f6479f935",
- "test_2_val_2.fq.gz:md5,d3c588c12646ebd36a0812fe02d0bda6"
- ]
- ]
- ],
- [
- [
- {
- "id": "test",
- "single_end": false
- },
- [
- "test_1_unpaired_1.fq.gz:md5,17e0e878f6d0e93b9008a05f128660b6",
- "test_2_unpaired_2.fq.gz:md5,b09a064368a867e099e66df5ef69b044"
- ]
- ]
- ]
- ],
- "meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.3"
- },
- "timestamp": "2025-01-06T12:25:46.461002981"
- }
-}
\ No newline at end of file
diff --git a/modules/nf-core/lima/environment.yml b/modules/nf-core/yahs/environment.yml
similarity index 86%
rename from modules/nf-core/lima/environment.yml
rename to modules/nf-core/yahs/environment.yml
index 2e56e30d..051b20b6 100644
--- a/modules/nf-core/lima/environment.yml
+++ b/modules/nf-core/yahs/environment.yml
@@ -3,6 +3,5 @@
channels:
- conda-forge
- bioconda
-
dependencies:
- - bioconda::lima=2.12.0
+ - bioconda::yahs=1.2.2
diff --git a/modules/nf-core/yahs/main.nf b/modules/nf-core/yahs/main.nf
new file mode 100644
index 00000000..cb338ae8
--- /dev/null
+++ b/modules/nf-core/yahs/main.nf
@@ -0,0 +1,52 @@
+process YAHS {
+ tag "${meta.id}"
+ label 'process_high'
+
+ conda "${moduleDir}/environment.yml"
+ container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ?
+ 'https://depot.galaxyproject.org/singularity/yahs:1.2.2--h577a1d6_1':
+ 'biocontainers/yahs:1.2.2--h577a1d6_1' }"
+
+ input:
+ tuple val(meta), path(fasta), path(fai), path(hic_map), path(agp)
+
+ output:
+ // note: typo in yahs file outputs - it writes "inital", not "initial"
+ tuple val(meta), path("${prefix}_scaffolds_final.fa") , emit: scaffolds_fasta , optional: true
+ tuple val(meta), path("${prefix}_scaffolds_final.agp") , emit: scaffolds_agp , optional: true
+ tuple val(meta), path("${prefix}_{inital,no}_break*.agp"), emit: initial_break_agp , optional: true
+ tuple val(meta), path("${prefix}_r*_*.agp") , emit: round_agp , optional: true
+ tuple val(meta), path("${prefix}.bin") , emit: binary
+ tuple val(meta), path("${prefix}.log") , emit: log
+ tuple val("${task.process}"), val('yahs'), eval("yahs --version 2>&1"), emit: versions_yahs, topic: versions
+
+ when:
+ task.ext.when == null || task.ext.when
+
+ script:
+ def args = task.ext.args ?: ''
+ prefix = task.ext.prefix ?: "${meta.id}"
+ def agp_input = agp ? "-a ${agp}" : ""
+ """
+ yahs \\
+ -o ${prefix} \\
+ ${agp_input} \\
+ ${args} \\
+ ${fasta} \\
+ ${hic_map} \\
+ 2>| >( tee ${prefix}.log >&2 )
+ """
+
+ stub:
+ prefix = task.ext.prefix ?: "${meta.id}"
+ """
+ touch ${prefix}_scaffolds_final.fa
+ touch ${prefix}_scaffolds_final.agp
+ touch ${prefix}_inital_break_01.agp
+ touch ${prefix}_no_break.agp
+ touch ${prefix}_r01.agp
+ touch ${prefix}_r01_break.agp
+ touch ${prefix}.bin
+ touch ${prefix}.log
+ """
+}
diff --git a/modules/nf-core/yahs/meta.yml b/modules/nf-core/yahs/meta.yml
new file mode 100644
index 00000000..3d06083c
--- /dev/null
+++ b/modules/nf-core/yahs/meta.yml
@@ -0,0 +1,150 @@
+name: "yahs"
+description: Performs assembly scaffolding using YaHS
+keywords:
+ - scaffolding
+ - assembly
+ - yahs
+ - hic
+tools:
+ - "yahs":
+ description: "YaHS, yet another Hi-C scaffolding tool."
+ homepage: "https://github.com/c-zhou/yahs"
+ documentation: "https://github.com/c-zhou/yahs"
+ tool_dev_url: "https://github.com/c-zhou/yahs"
+ doi: "10.1093/bioinformatics/btac808"
+ licence:
+ - "MIT"
+ identifier: biotools:yahs
+input:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - fasta:
+ type: file
+ description: FASTA reference file
+ pattern: "*.{fasta,fa}"
+ ontologies:
+ - edam: http://edamontology.org/format_1929
+ - fai:
+ type: file
+ description: index of the reference file
+ pattern: "*.{fai}"
+ ontologies:
+ - edam: http://edamontology.org/format_3475
+ - hic_map:
+ type: file
+ description: BED file containing coordinates of read alignments
+ pattern: "*.{bed,bam,bin}"
+ ontologies:
+ - edam: http://edamontology.org/format_3003
+ - edam: http://edamontology.org/format_2572
+ - agp:
+ type: file
+ description: |
+ Optional AGP file describing a set of scaffolds from the input contigs
+ to use as a start point
+ pattern: "*.agp"
+ ontologies:
+ - edam: http://edamontology.org/format_3693
+output:
+ scaffolds_fasta:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}_scaffolds_final.fa:
+ type: file
+ description: FASTA file with resulting contigs
+ pattern: "${prefix}_scaffolds_final.fa"
+ ontologies:
+ - edam: http://edamontology.org/format_1929
+ scaffolds_agp:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}_scaffolds_final.agp:
+ type: file
+ description: AGP file containing contigs placing coordinates
+ pattern: "${prefix}_scaffolds_final.agp"
+ ontologies:
+ - edam: http://edamontology.org/format_3693
+ initial_break_agp:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}_{inital,no}_break*.agp:
+ type: file
+ description: AGP file describing initial contig breaks
+ pattern: "${prefix}_{inital,no}_break*.agp"
+ ontologies:
+ - edam: http://edamontology.org/format_3693
+ round_agp:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}_r*_*.agp:
+ type: file
+ description: AGP file describing intermediate rounds of scaffolding
+ pattern: "${prefix}_{initial,no}_break*.agp"
+ ontologies:
+ - edam: http://edamontology.org/format_3693
+ binary:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}.bin:
+ type: file
+ description: |
+ Binary data file with alignment results of Hi-C reads
+ to the contigs in internal YaHS binary format
+ pattern: "${prefix}.bin"
+ ontologies: []
+ log:
+ - - meta:
+ type: map
+ description: |
+ Groovy Map containing sample information
+ e.g. [ id:'test' ]
+ - ${prefix}.log:
+ type: file
+ description: Log file describing YaHS run
+ pattern: "${prefix}.log"
+ ontologies:
+ - edam: "http://edamontology.org/format_2330"
+ versions_yahs:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - yahs:
+ type: string
+ description: The name of the tool
+ - yahs --version 2>&1:
+ type: eval
+ description: The expression to obtain the version of the tool
+topics:
+ versions:
+ - - ${task.process}:
+ type: string
+ description: The name of the process
+ - yahs:
+ type: string
+ description: The name of the tool
+ - yahs --version 2>&1:
+ type: eval
+ description: The expression to obtain the version of the tool
+authors:
+ - "@ksenia-krasheninnikova"
+maintainers:
+ - "@ksenia-krasheninnikova"
+ - "@yy5"
diff --git a/modules/nf-core/yahs/tests/main.nf.test b/modules/nf-core/yahs/tests/main.nf.test
new file mode 100644
index 00000000..e676604d
--- /dev/null
+++ b/modules/nf-core/yahs/tests/main.nf.test
@@ -0,0 +1,138 @@
+nextflow_process {
+
+ name "Test Process YAHS"
+ script "../main.nf"
+ process "YAHS"
+ config "./nextflow.config"
+
+ tag "modules"
+ tag "modules_nfcore"
+ tag "yahs"
+
+ test("homo_sapiens - bam - fasta - fai") {
+
+ when {
+
+ params {
+ yahs_args = ""
+ }
+
+ process {
+ """
+ input[0] = [
+ [ id: "test" ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ []
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ process.out.scaffolds_fasta,
+ process.out.scaffolds_agp,
+ process.out.initial_break_agp,
+ process.out.round_agp,
+ process.out.binary,
+ process.out.findAll { key, val -> key.startsWith("versions")},
+ ).match() },
+ { file(process.out.log.get(0).get(1)).readLines().last().contains("Real time") }
+ )
+ }
+ }
+
+ test("homo_sapiens - bam - fasta - fai - agp") {
+
+ setup {
+
+ run("YAHS", alias: "YAHS_INIT") {
+ script "../main.nf"
+ process {
+ """
+ input[0] = [
+ [ id: "test" ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ []
+ ]
+ """
+ }
+ }
+
+ }
+
+ when {
+
+ params {
+ yahs_args = "--no-contig-ec"
+ }
+
+ process {
+ """
+ input[0] = channel.of(
+ [
+ [ id: "test" ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ ]
+ ).combine(YAHS_INIT.out.scaffolds_agp, by: 0)
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(
+ process.out.scaffolds_fasta,
+ process.out.scaffolds_agp,
+ process.out.initial_break_agp,
+ process.out.round_agp,
+ process.out.binary,
+ process.out.findAll { key, val -> key.startsWith("versions")},
+ ).match() },
+ { file(process.out.log.get(0).get(1)).readLines().last().contains("Real time") }
+ )
+ }
+ }
+
+ test("homo_sapiens - bam - fasta - fai - stub") {
+
+ options "-stub"
+
+ when {
+
+ params {
+ yahs_args = ""
+ }
+
+ process {
+ """
+ input[0] = [
+ [ id: "test" ],
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true),
+ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true),
+ []
+ ]
+ """
+ }
+ }
+
+ then {
+ assertAll(
+ { assert process.success },
+ { assert snapshot(process.out).match() }
+ )
+ }
+ }
+
+
+}
diff --git a/modules/nf-core/yahs/tests/main.nf.test.snap b/modules/nf-core/yahs/tests/main.nf.test.snap
new file mode 100644
index 00000000..e41229da
--- /dev/null
+++ b/modules/nf-core/yahs/tests/main.nf.test.snap
@@ -0,0 +1,230 @@
+{
+ "homo_sapiens - bam - fasta - fai - stub": {
+ "content": [
+ {
+ "0": [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "1": [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "2": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test_inital_break_01.agp:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_no_break.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "3": [
+ [
+ {
+ "id": "test"
+ },
+ "test_r01_break.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "4": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bin:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "5": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "6": [
+ [
+ "YAHS",
+ "yahs",
+ "1.2.2"
+ ]
+ ],
+ "binary": [
+ [
+ {
+ "id": "test"
+ },
+ "test.bin:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "initial_break_agp": [
+ [
+ {
+ "id": "test"
+ },
+ [
+ "test_inital_break_01.agp:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_no_break.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ]
+ ],
+ "log": [
+ [
+ {
+ "id": "test"
+ },
+ "test.log:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "round_agp": [
+ [
+ {
+ "id": "test"
+ },
+ "test_r01_break.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "scaffolds_agp": [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.agp:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "scaffolds_fasta": [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.fa:md5,d41d8cd98f00b204e9800998ecf8427e"
+ ]
+ ],
+ "versions_yahs": [
+ [
+ "YAHS",
+ "yahs",
+ "1.2.2"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T13:13:16.431723"
+ },
+ "homo_sapiens - bam - fasta - fai": {
+ "content": [
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.fa:md5,a767604036a4cd6980ebd24f11e4dd95"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.agp:md5,374235b079d9e1c738c6f12697029b78"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test_inital_break_01.agp:md5,374235b079d9e1c738c6f12697029b78"
+ ]
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test.bin:md5,da45a2ec8a97fc24783e9a63373db379"
+ ]
+ ],
+ {
+ "versions_yahs": [
+ [
+ "YAHS",
+ "yahs",
+ "1.2.2"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T13:13:08.310976"
+ },
+ "homo_sapiens - bam - fasta - fai - agp": {
+ "content": [
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.fa:md5,a767604036a4cd6980ebd24f11e4dd95"
+ ]
+ ],
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test_scaffolds_final.agp:md5,374235b079d9e1c738c6f12697029b78"
+ ]
+ ],
+ [
+
+ ],
+ [
+
+ ],
+ [
+ [
+ {
+ "id": "test"
+ },
+ "test.bin:md5,da45a2ec8a97fc24783e9a63373db379"
+ ]
+ ],
+ {
+ "versions_yahs": [
+ [
+ "YAHS",
+ "yahs",
+ "1.2.2"
+ ]
+ ]
+ }
+ ],
+ "meta": {
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
+ },
+ "timestamp": "2026-02-10T13:13:12.93575"
+ }
+}
\ No newline at end of file
diff --git a/modules/nf-core/yahs/tests/nextflow.config b/modules/nf-core/yahs/tests/nextflow.config
new file mode 100644
index 00000000..15279238
--- /dev/null
+++ b/modules/nf-core/yahs/tests/nextflow.config
@@ -0,0 +1,10 @@
+process {
+
+ withName: 'YAHS' {
+ ext.args = params.yahs_args
+ }
+
+ withName: 'YAHS_INIT' {
+ ext.args = params.yahs_args
+ }
+}
diff --git a/nextflow.config b/nextflow.config
index d20e92b5..c60089a1 100644
--- a/nextflow.config
+++ b/nextflow.config
@@ -42,38 +42,62 @@ params {
// Pipeline params
input = '' // input file
outdir = null // outdir
- use_ref = true // use a reference genome (requires fasta + gff)
- skip_alignments = false // Intended for QC-oriented (re)-runs, alignments (to ref) are provided
- skip_assembly = false // Intended for QC-oriented (re)-runs, assemblies are provided
+ csi_index_size = 14
+ // Assembly strategy
+ strategy = "single" // assembly_strategy
+ assembler = null
+ assembler_ont = null
+ assembler_hifi = null
+ assembler_ont_args = ''
+ assembler_hifi_args = ''
+ flye_mode = '--nano-hq'
+ // == Read QC and trimming ==
// -- ONT
- ont = false // ont reads available?
- collect = false // collect ONT reads into a single file
- porechop = false // run porechop on ONT
- read_length = null // avg read length, can be estimated from reads
- // -- Jellyfish (ONT reads only) --
- jellyfish = true // run jellyfish
- dump = false // dump output
- kmer_length = 21 // kmer length
+ ontreads = null
+ ont_collect = false // collect ONT reads into a single file
+ ont_adapters = [] // list of adapters for fastplong
+ ont_fastplong_args = '' // args for fastplong
+ // -- Jellyfish (qc reads) --
+ jellyfish = false
+ jellyfish_k = 21
// -- HiFi --
- hifi = false // HiFi reads available?
- lima = false // run lima on HiFi reads?
- pacbio_primers = null // if lima, then this needs to be a path to a list of primers
- // -- ASSEMBLY
- assembler = "flye" // assembler to use
+ hifireads = null
+ hifi_adapters = []
+ hifi_fastplong_args = '' // args for fastplong
+ // -- Short read --
+ use_short_reads = false // short reads available?
+ shortread_trim = false // trim short reads?
+ shortread_F = [] // fwd shortreads
+ shortread_R = [] // rev shortreads
+ paired = null
+ // HiC
+ hic_aligner = "bwa-mem2"
+ hic_F = []
+ hic_R = []
+ hic_trim = true
+ // == ASSEMBLY ==
+ assembler = "hifiasm" // assembler to use
+ assembly_scaffolding_order = "ont_on_hifi"
// -- Assembly: Flye --
genome_size = null // genomesize, optional, can be estimated from ONT reads
- flye_mode = '--nano-hq' // flye mode
- flye_args = "" // extra flye args
+ // DEPRECATED: flye_mode = '--nano-hq'
+ flye_args = '' // extra flye args
// -- Assembly: hifiasm --
- hifiasm_ont = false // combine hifi and ONT with hifiasm --ul?
- hifiasm_args = "" // extra hifiasm args
- // -- Short read --
- short_reads = false // short reads available?
- trim_short_reads = true // trim short reads?
+ hifiasm_args = '' // extra hifiasm args
+ // QC Oriented extra options
+ assembly = null
+ ref_map_bam = null
+ assembly_map_bam = null
+ // == Reference ==
+ use_ref = false // use a reference genome (requires fasta + gff)
+ ref_fasta = null
+ ref_gff = null
// -- POLISHING
// -- Polish: medaka
polish_medaka = false // run medaka
- medaka_model = "" // model for medaka, if empty medaka will guess
+ medaka_model = '' // model for medaka, if empty medaka will guess
+ // -- Polish: dorado
+ polish_dorado = false
// -- Polish: pilon
polish_pilon = false // run pilon
// -- QC --
@@ -81,16 +105,17 @@ params {
meryl_k = 21 // k for meryl
merqury = true
// -- QC : Busco
- busco = true // run busco
+ busco = false // run busco
busco_db = '' // path to busco db
- busco_lineage = "brassicales_odb10" // busco lineage
+ busco_lineage = "auto_euk" // busco lineage
// -- QC: QUAST
- quast = true // run quast
- qc_reads = "ONT" // if both ONT and HiFi reads are available, which should be used for QC alignments
+ quast = false // run quast
+ qc_reads = "ont" // if both ONT and HiFi reads are available, which should be used for QC alignments
// -- SCAFFOLDING
scaffold_links = false // Scaffold with LINKS
scaffold_longstitch = false // Scaffold with Longstitch
scaffold_ragtag = false // Scaffold with ragtag
+ scaffold_hic = true // Scaffold with HiC
// -- ANNOTATIONS
lift_annotations = true // lift annotations from reference (if reference is provided)
}
@@ -104,8 +129,6 @@ profiles {
process.beforeScript = 'echo $HOSTNAME'
cleanup = false
nextflow.enable.configProcessNamesValidation = true
- dumpHashes = true
-
}
conda {
conda.enabled = true
@@ -227,13 +250,6 @@ profiles {
test { includeConfig 'conf/test.config' }
test_full { includeConfig 'conf/test_full.config' }
- hifi_flye { includeConfig 'configs/hifi_flye.config' } // Hifi-reads with flye
- hifi_hifiasm { includeConfig 'configs/hifi_hifiasm.config' } // hifi-reads with hifiasm
- ont_flye { includeConfig 'configs/ont_flye.config' } // ont-reads with flye
- ont_hifiasm { includeConfig 'configs/ont_hifiasm.config' } // ont-reads with hifiasm
- hifiont_hifiasm { includeConfig 'configs/hifi_ont_hifiasm_ul.config' } // ont and hifi reads with hifiasm --ul
- hifiont_flye_on_hifiasm { includeConfig 'configs/hifi_ont_flye_on_hifiasm.config' } // ont and hifi reads. ONT via flye, Hifi via hifiasm, scaffold flye on hifiasm
- hifiont_hifiasm_on_hifiasm { includeConfig 'configs/hifi_ont_hifiasm_on_hifiasm.config' } // ont and hifi reads. ONT via hifiasm, Hifi via hifiasm, scaffold ONT on HiFi
}
// Load nf-core custom profiles from different institutions
@@ -242,12 +258,6 @@ profiles {
// Load nf-core/genomeassembler custom profiles from different institutions.
includeConfig params.custom_config_base && (!System.getenv('NXF_OFFLINE') || !params.custom_config_base.startsWith('http')) ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null"
-// Load nf-core custom profiles from different institutions
-
-// If params.custom_config_base is set AND either the NXF_OFFLINE environment variable is not set or params.custom_config_base is a local path, the nfcore_custom.config file from the specified base path is included.
-// Load nf-core/genomeassembler custom profiles from different institutions.
-includeConfig params.custom_config_base && (!System.getenv('NXF_OFFLINE') || !params.custom_config_base.startsWith('http')) ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null"
-
// Load nf-core/genomeassembler custom profiles from different institutions.
includeConfig params.custom_config_base && (!System.getenv('NXF_OFFLINE') || !params.custom_config_base.startsWith('http')) ? "${params.custom_config_base}/pipeline/genomeassembler.config" : "/dev/null"
@@ -286,22 +296,22 @@ process.shell = [
// Disable process selector warnings by default. Use debug profile to enable warnings.
nextflow.enable.configProcessNamesValidation = false
-def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
+
timeline {
enabled = true
- file = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html"
+ file = "${params.outdir}/pipeline_info/execution_timeline_${params.trace_report_suffix}.html"
}
report {
enabled = true
- file = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html"
+ file = "${params.outdir}/pipeline_info/execution_report_${params.trace_report_suffix}.html"
}
trace {
enabled = true
- file = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt"
+ file = "${params.outdir}/pipeline_info/execution_trace_${params.trace_report_suffix}.txt"
}
dag {
enabled = true
- file = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html"
+ file = "${params.outdir}/pipeline_info/pipeline_dag_${params.trace_report_suffix}.html"
}
manifest {
@@ -321,8 +331,8 @@ manifest {
description = """Assemble genomes from long ONT or pacbio HiFi reads"""
mainScript = 'main.nf'
defaultBranch = 'master'
- nextflowVersion = '!>=25.04.0'
- version = '1.1.0'
+ nextflowVersion = '!>=25.10.0'
+ version = '2.0.0dev'
doi = '10.5281/zenodo.14986998'
}
diff --git a/nextflow_schema.json b/nextflow_schema.json
index 636070bc..da2d9da1 100644
--- a/nextflow_schema.json
+++ b/nextflow_schema.json
@@ -151,108 +151,54 @@
}
}
},
- "general_parameters": {
- "title": "General parameters",
+ "reference_parameters": {
+ "title": "Reference Parameters",
"type": "object",
"description": "Options controlling pipeline behavior",
"default": "",
"properties": {
- "use_ref": {
- "type": "boolean",
- "description": "use reference genome",
- "default": true
+ "ref_fasta": {
+ "type": "string",
+ "description": "Path to reference genome seqeunce (fasta)"
},
- "skip_assembly": {
- "type": "boolean",
- "description": "skip assembly steps",
- "help_text": "Skip assembly and perform only qc. Requires 'assembly' column in the samplesheet"
+ "ref_gff": {
+ "type": "string",
+ "description": "Path to reference genome annotations (gff)"
},
- "skip_alignments": {
+ "use_ref": {
"type": "boolean",
- "description": "skip alignments during qc"
+ "description": "use reference genome",
+ "hidden": true
}
},
"fa_icon": "fas fa-bacon"
},
- "ont_options": {
- "title": "ONT options",
- "type": "object",
- "description": "Options for ONT reads",
- "default": "",
- "properties": {
- "ont": {
- "type": "boolean",
- "description": "ONT reads available?"
- },
- "collect": {
- "type": "boolean",
- "description": "collect ONT reads into a single file"
- },
- "porechop": {
- "type": "boolean",
- "description": "run porechop on ONT reads"
- },
- "read_length": {
- "type": "integer",
- "description": "read length for genomescope (ONT only)",
- "minimum": 1
- },
- "jellyfish": {
- "type": "boolean",
- "description": "run jellyfish on ONT reads to compute k-mer distribution and estimate genome size",
- "default": true
- },
- "dump": {
- "type": "boolean",
- "description": "dump jellyfish output"
- },
- "kmer_length": {
- "type": "integer",
- "description": "kmer length to be used for jellyfish",
- "default": 21,
- "minimum": 1
- }
- }
- },
- "hifi_options": {
- "title": "HiFi options",
- "type": "object",
- "description": "Options for HiFi reads",
- "default": "",
- "properties": {
- "hifi": {
- "type": "boolean",
- "description": "HiFi reads available?"
- },
- "lima": {
- "type": "boolean",
- "description": "run lima on HiFi reads?"
- },
- "pacbio_primers": {
- "type": "string",
- "format": "file-path",
- "exists": true,
- "pattern": "^\\S+\\.fn?a(sta)?$",
- "description": "file containing pacbio primers for trimming with lima"
- }
- }
- },
"assembly_options": {
"title": "Assembly options",
"type": "object",
"description": "Options controlling assembly",
"default": "",
"properties": {
+ "strategy": {
+ "type": "string",
+ "default": "single",
+ "description": "Assembly strategy to use. Valid choices are `'single'`, `'hybrid'` and `'scaffold'`"
+ },
"assembler": {
"type": "string",
- "description": "Assembler to use. Valid choices are: `'hifiasm'`, `'flye'`, `'flye_on_hifiasm'` or `hifiasm_on_hifiasm`. `flye_on_hifiasm` will scaffold flye assembly (ont) on hifiasm (hifi) assembly using ragtag. `hifiasm_on_hifiasm` will scaffold hifiasm (ont) onto hifiasm (HiFi) using ragtag",
- "enum": ["flye", "hifiasm", "flye_on_hifiasm", "hifiasm_on_hifiasm"],
- "default": "flye"
+ "description": "Assembler to use. Valid choices depend on strategy; for single either `flye` or `hifiasm`, hybrid can be done with `hifiasm` and for scaffolded assembly provide the names of the assemblers separated with an underscore. The first assembler will be used for ONT reads, the second for HiFi reads. (see below, asembler1 and assembler_hifi)",
+ "enum": ["flye", "hifiasm", "flye_hifiasm", "hifiasm_hifiasm", "flye_flye", "hifiasm_flye"],
+ "default": "hifiasm"
+ },
+ "assembly_scaffolding_order": {
+ "type": "string",
+ "default": "ont_on_hifi",
+ "description": "When strategy is \"scaffold\", which assembly should be scaffolded onto which?",
+ "enum": ["ont_on_hifi", "hifi_on_ont"]
},
"genome_size": {
- "type": "integer",
- "description": "expected genome size, optional",
- "minimum": 1
+ "type": "string",
+ "description": "expected genome size, optional"
},
"flye_mode": {
"type": "string",
@@ -264,36 +210,72 @@
"type": "string",
"description": "additional args for flye"
},
- "hifiasm_ont": {
- "type": "boolean",
- "description": "Use hifi and ONT reads with `hifiasm --ul`"
- },
"hifiasm_args": {
"type": "string",
"description": "Extra arguments passed to `hifiasm`"
+ },
+ "assembler_ont": {
+ "type": "string",
+ "description": "assembler_ont assembles ONT reads. This option is mainly useful when building more complex samplesheets"
+ },
+ "assembler_ont_args": {
+ "type": "string",
+ "description": "Arguments to be passed to assembler_ont (ONT)"
+ },
+ "assembler_hifi": {
+ "type": "string",
+ "description": "assembler_hifi assembles HiFi reads. This option is mainly useful when building more complex samplesheets"
+ },
+ "assembler_hifi_args": {
+ "type": "string",
+ "description": "Arguments to be passed to assembler_hifi (HiFi)"
}
}
},
- "short_read_options": {
- "title": "Short read options",
+ "long_read_preprocessing": {
+ "title": "Long-read preprocessing",
"type": "object",
- "description": "Options for short reads",
+ "description": "",
"default": "",
"properties": {
- "short_reads": {
+ "ontreads": {
+ "type": "string",
+ "description": "Path to ONT reads"
+ },
+ "ont_collect": {
"type": "boolean",
- "description": "Short reads available?"
+ "description": "Collect ONT reads from several files?"
},
- "trim_short_reads": {
+ "ont_adapters": {
+ "type": "string",
+ "default": "[]",
+ "description": "Adaptors for ONT read-trimming"
+ },
+ "ont_fastplong_args": {
+ "type": "string",
+ "description": "Additional args to be passed to fastplong for ONT reads"
+ },
+ "hifireads": {
+ "type": "string",
+ "description": "Path to HiFi reads"
+ },
+ "hifi_adapters": {
+ "type": "string",
+ "default": "[]",
+ "description": "Adaptors for HiFi read-trimming"
+ },
+ "hifi_fastplong_args": {
+ "type": "string",
+ "description": "Additional args to be passed to fastplong for HiFi reads"
+ },
+ "jellyfish": {
"type": "boolean",
- "description": "trim short reads with trimgalore",
- "default": true
+ "description": "Run jellyfish and genomescope (recommended)"
},
- "meryl_k": {
+ "jellyfish_k": {
"type": "integer",
- "description": "kmer length for meryl / merqury",
"default": 21,
- "minimum": 1
+ "description": "Value of k used during k-mer analysis with jellyfish"
}
}
},
@@ -307,6 +289,10 @@
"type": "boolean",
"description": "Polish assembly with pilon? Requires short reads"
},
+ "polish_dorado": {
+ "type": "boolean",
+ "description": "Polish assembly with dorado (ONT only)"
+ },
"polish_medaka": {
"type": "boolean",
"description": "Polish assembly with medaka (ONT only)"
@@ -334,6 +320,17 @@
"scaffold_ragtag": {
"type": "boolean",
"description": "Scaffold with ragtag (requires reference)?"
+ },
+ "scaffold_hic": {
+ "type": "boolean",
+ "description": "Scaffold using HiC reads using yahs (requires reads)?",
+ "default": true
+ },
+ "hic_aligner": {
+ "type": "string",
+ "enum": ["bwa-mem2", "minimap2"],
+ "description": "Aligner to use for HiC reads; default: bwa-mem2",
+ "default": "bwa-mem2"
}
}
},
@@ -346,18 +343,17 @@
"merqury": {
"type": "boolean",
"default": true,
- "description": "Run merqury"
+ "description": "Run merqury (if short reads are provided)"
},
"qc_reads": {
"type": "string",
- "description": "Long reads that should be used for QC when both ONT and HiFi reads are provided. Options are `'ONT'` or `'HIFI'`",
- "enum": ["ONT", "HIFI"],
- "default": "ONT"
+ "description": "Long reads that should be used for QC when both ONT and HiFi reads are provided. Options are `'ont'` or `'hifi'`",
+ "enum": ["ont", "hifi"],
+ "default": "ont"
},
"busco": {
"type": "boolean",
- "description": "Run BUSCO?",
- "default": true
+ "description": "Run BUSCO?"
},
"busco_db": {
"type": "string",
@@ -367,12 +363,28 @@
"busco_lineage": {
"type": "string",
"description": "Busco lineage to use",
- "default": "brassicales_odb10"
+ "default": "auto_euk"
},
"quast": {
"type": "boolean",
- "description": "Run quast",
- "default": true
+ "description": "Run quast"
+ },
+ "ref_map_bam": {
+ "type": "string",
+ "description": "A mapping (bam) of reads mapped to the reference can be provided for QC. If provided, alignment to reference fasta will not run."
+ },
+ "assembly": {
+ "type": "string",
+ "description": "Can be used to proved existing assembly will skip assembly and perform downstream steps including qc"
+ },
+ "assembly_map_bam": {
+ "type": "string",
+ "description": "A mapping (bam) of reads mapped to the provided assembly can be specified for QC. If provided, alignment to the provided assembly fasta will not run"
+ },
+ "csi_index_size": {
+ "type": "integer",
+ "description": "Index size to use for csi index (default: 14), creating and index of size 2^csi_index_size. See samtools index documentation for details. ",
+ "default": 14
}
}
},
@@ -384,10 +396,69 @@
"properties": {
"lift_annotations": {
"type": "boolean",
- "description": "Lift-over annotations (requires reference)?",
+ "description": "Lift-over annotations (requires ref_gff)?",
"default": true
}
}
+ },
+ "short_read_options": {
+ "title": "Short read options",
+ "type": "object",
+ "description": "Options for short reads",
+ "default": "",
+ "properties": {
+ "use_short_reads": {
+ "type": "boolean",
+ "description": "Use short reads?"
+ },
+ "shortread_trim": {
+ "type": "boolean",
+ "description": "Trim short reads?"
+ },
+ "meryl_k": {
+ "type": "integer",
+ "description": "kmer length for meryl / merqury",
+ "default": 21,
+ "minimum": 1
+ },
+ "shortread_F": {
+ "type": "string",
+ "description": "Path to forward short reads",
+ "default": "[]"
+ },
+ "shortread_R": {
+ "type": "string",
+ "description": "Path to reverse short reads",
+ "default": "[]"
+ },
+ "paired": {
+ "type": "string",
+ "description": "Are shortreads paired?"
+ }
+ }
+ },
+ "hic_options": {
+ "title": "HiC short read options",
+ "type": "object",
+ "description": "Options for HiC short reads",
+ "default": "",
+ "properties": {
+ "hic_trim": {
+ "type": "boolean",
+ "description": "Trim HiC short reads?",
+ "default": true
+ },
+ "hic_F": {
+ "type": "string",
+ "description": "Path to forward HiC short reads",
+ "default": "[]"
+ },
+ "hic_R": {
+ "type": "string",
+ "description": "Path to reverse HiC short reads",
+ "default": "[]"
+ }
+ }
}
},
"allOf": [
@@ -401,19 +472,13 @@
"$ref": "#/$defs/generic_options"
},
{
- "$ref": "#/$defs/general_parameters"
- },
- {
- "$ref": "#/$defs/ont_options"
- },
- {
- "$ref": "#/$defs/hifi_options"
+ "$ref": "#/$defs/reference_parameters"
},
{
"$ref": "#/$defs/assembly_options"
},
{
- "$ref": "#/$defs/short_read_options"
+ "$ref": "#/$defs/long_read_preprocessing"
},
{
"$ref": "#/$defs/polishing_options"
@@ -426,6 +491,12 @@
},
{
"$ref": "#/$defs/annotations_options"
+ },
+ {
+ "$ref": "#/$defs/short_read_options"
+ },
+ {
+ "$ref": "#/$defs/hic_options"
}
]
}
diff --git a/ro-crate-metadata.json b/ro-crate-metadata.json
index c87dc35b..4a4fad02 100644
--- a/ro-crate-metadata.json
+++ b/ro-crate-metadata.json
@@ -23,7 +23,7 @@
"@type": "Dataset",
"creativeWorkStatus": "Stable",
"datePublished": "2025-11-20T09:31:46+00:00",
- "description": "\n \n \n \n \n\n[](https://github.com/codespaces/new/nf-core/genomeassembler)\n[](https://github.com/nf-core/genomeassembler/actions/workflows/nf-test.yml)\n[](https://github.com/nf-core/genomeassembler/actions/workflows/linting.yml)[](https://nf-co.re/genomeassembler/results)[](https://doi.org/10.5281/zenodo.XXXXXXX)\n[](https://www.nf-test.com)\n\n[](https://www.nextflow.io/)\n[](https://github.com/nf-core/tools/releases/tag/3.5.1)\n[](https://docs.conda.io/en/latest/)\n[](https://www.docker.com/)\n[](https://sylabs.io/docs/)\n[](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/genomeassembler)\n\n[](https://nfcore.slack.com/channels/genomeassembler)[](https://bsky.app/profile/nf-co.re)[](https://mstdn.science/@nf_core)[](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/genomeassembler** is a bioinformatics pipeline that ...\n\n\n\n\n1. Read QC ([`FastQC`](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/))\n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\n\n\nNow, you can run the pipeline using:\n\n\n\n```bash\nnextflow run nf-core/genomeassembler \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/genomeassembler/usage) and the [parameter documentation](https://nf-co.re/genomeassembler/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/genomeassembler/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/genomeassembler/output).\n\n## Credits\n\nnf-core/genomeassembler was originally written by Niklas Schandry.\n\nWe thank the following people for their extensive assistance in the development of this pipeline:\n\n\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#genomeassembler` channel](https://nfcore.slack.com/channels/genomeassembler) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\n\n\n\n\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n",
+ "description": "\n \n \n \n \n\n[](https://github.com/codespaces/new/nf-core/genomeassembler)\n[](https://github.com/nf-core/genomeassembler/actions/workflows/nf-test.yml)\n[](https://github.com/nf-core/genomeassembler/actions/workflows/linting.yml)[](https://nf-co.re/genomeassembler/results)[](https://doi.org/10.5281/zenodo.14986998)\n[](https://www.nf-test.com)\n\n[](https://www.nextflow.io/)\n[](https://github.com/nf-core/tools/releases/tag/3.5.1)\n[](https://docs.conda.io/en/latest/)\n[](https://www.docker.com/)\n[](https://sylabs.io/docs/)\n[](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/genomeassembler)\n\n[](https://nfcore.slack.com/channels/genomeassembler)[](https://bsky.app/profile/nf-co.re)[](https://mstdn.science/@nf_core)[](https://www.youtube.com/c/nf-core)\n\n## Introduction\n\n**nf-core/genomeassembler** is a bioinformatics pipeline that carries out genome assembly, polishing and scaffolding from long reads (ONT or pacbio). Assembly can be done via `flye` or `hifiasm`, polishing can be carried out with `medaka` (ONT), or `pilon` (requires short-reads), and scaffolding can be done using `LINKS`, `Longstitch`, or `RagTag` (if a reference is available). Quality control includes `BUSCO`, `QUAST` and `merqury` (requires short-reads).\nCurrently, this pipeline does not implement phasing of polyploid genomes or HiC scaffolding.\n\n\n \n \n\n## Usage\n\n> [!NOTE]\n> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data.\n\nFirst, prepare a samplesheet with your input data that looks as follows:\n\n`samplesheet.csv`:\n\n```csv\nsample,ontreads,hifireads,ref_fasta,ref_gff,shortread_F,shortread_R,paired\nsampleName,ontreads.fa.gz,hifireads.fa.gz,assembly.fasta.gz,reference.fasta,reference.gff,short_F1.fastq,short_F2.fastq,true\n```\n\nEach row represents one genome to be assembled. `sample` should contain the name of the sample, `ontreads` should contain a path to ONT reads (fastq.gz), `hifireads` a path to HiFi reads (fastq.gz), `ref_fasta` and `ref_gff` contain reference genome fasta and annotations. `shortread_F` and `shortread_R` contain paths to short-read data, `paired` indicates if short-reads are paired. Columns can be omitted if they contain no data, with the exception of `shortread_R`, which needs to be present if `shortread_F` is there, even if it is empty.\n\nNow, you can run the pipeline using:\n\n```bash\nnextflow run nf-core/genomeassembler \\\n -profile \\\n --input samplesheet.csv \\\n --outdir \n```\n\n> [!WARNING]\n> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files).\n\nFor more details and further functionality, please refer to the [usage documentation](https://nf-co.re/genomeassembler/usage) and the [parameter documentation](https://nf-co.re/genomeassembler/parameters).\n\n## Pipeline output\n\nTo see the results of an example test run with a full size dataset refer to the [results](https://nf-co.re/genomeassembler/results) tab on the nf-core website pipeline page.\nFor more details about the output files and reports, please refer to the\n[output documentation](https://nf-co.re/genomeassembler/output).\n\n## Credits\n\nnf-core/genomeassembler was written, and is currently maintained by [Niklas Schandry](https://github.com/nschan), of the Faculty of Biology of the Ludwig-Maximilians University (LMU) in Munich, Germany, with funding support from the German Research Foundation (Deutsche Forschungsgemeinschaft\u00a0[DFG], via Transregional Research Center TRR356 grant 491090170-A05 to Niklas Schandry).\n\nI thank the following people for their extensive assistance and constructive reviews during the development of this pipeline:\n\n- [Mahesh Binzer-Panchal](https://github.com/mahesh-panchal)\n- [Matthias H\u00f6rtenhuber](https://github.com/mashehu)\n- [Louis Le N\u00e9zet](https://github.com/LouisLeNezet)\n- [J\u00falia Mir Pedrol](https://github.com/mirpedrol)\n- [Daniel Straub](https://github.com/d4straub)\n\n## Contributions and Support\n\nIf you would like to contribute to this pipeline, please see the [contributing guidelines](.github/CONTRIBUTING.md).\n\nFor further information or help, don't hesitate to get in touch on the [Slack `#genomeassembler` channel](https://nfcore.slack.com/channels/genomeassembler) (you can join with [this invite](https://nf-co.re/join/slack)).\n\n## Citations\n\nIf you use nf-core/genomeassembler for your analysis, please cite it using the following doi: [10.5281/zenodo.14986998](https://doi.org/10.5281/zenodo.14986998)\n\nAn extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file.\n\nYou can cite the `nf-core` publication as follows:\n\n> **The nf-core framework for community-curated bioinformatics pipelines.**\n>\n> Philip Ewels, Alexander Peltzer, Sven Fillinger, Harshil Patel, Johannes Alneberg, Andreas Wilm, Maxime Ulysse Garcia, Paolo Di Tommaso & Sven Nahnsen.\n>\n> _Nat Biotechnol._ 2020 Feb 13. doi: [10.1038/s41587-020-0439-x](https://dx.doi.org/10.1038/s41587-020-0439-x).\n",
"hasPart": [
{
"@id": "main.nf"
@@ -137,26 +137,39 @@
"@id": "https://orcid.org/0000-0003-3099-7860"
},
{
- "@id": "https://orcid.org/0000-0002-7860-3560"
+ "@id": "https://orcid.org/0000-0003-1675-0677"
},
{
- "@id": "https://orcid.org/0000-0003-1675-0677"
+ "@id": "https://orcid.org/0000-0002-7860-3560"
}
],
"dateCreated": "",
"dateModified": "2025-11-20T09:31:46Z",
"dct:conformsTo": "https://bioschemas.org/profiles/ComputationalWorkflow/1.0-RELEASE/",
- "keywords": ["nf-core", "nextflow", "genome-assembly"],
- "license": ["MIT"],
- "name": ["nf-core/genomeassembler"],
+ "keywords": [
+ "nf-core",
+ "nextflow",
+ "genome-assembly"
+ ],
+ "license": [
+ "MIT"
+ ],
+ "name": [
+ "nf-core/genomeassembler"
+ ],
"programmingLanguage": {
"@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow"
},
"sdPublisher": {
"@id": "https://nf-co.re/"
},
- "url": ["https://github.com/nf-core/genomeassembler", "https://nf-co.re/genomeassembler/1.1.0/"],
- "version": ["1.1.0"]
+ "url": [
+ "https://github.com/nf-core/genomeassembler",
+ "https://nf-co.re/genomeassembler/1.1.0/"
+ ],
+ "version": [
+ "1.1.0"
+ ]
},
{
"@id": "https://w3id.org/workflowhub/workflow-ro-crate#nextflow",
@@ -328,17 +341,17 @@
"email": "niklas@bio.lmu.de",
"name": "Niklas Schandry"
},
- {
- "@id": "https://orcid.org/0000-0002-7860-3560",
- "@type": "Person",
- "email": "mm49@sanger.ac.uk",
- "name": "Matthieu Muffato"
- },
{
"@id": "https://orcid.org/0000-0003-1675-0677",
"@type": "Person",
"email": "mahesh.binzer-panchal@nbis.se",
"name": "Mahesh Binzer-Panchal"
+ },
+ {
+ "@id": "https://orcid.org/0000-0002-7860-3560",
+ "@type": "Person",
+ "email": "mm49@sanger.ac.uk",
+ "name": "Matthieu Muffato"
}
]
}
\ No newline at end of file
diff --git a/subworkflows/local/assemble/main.nf b/subworkflows/local/assemble/main.nf
index 1030beb9..243036f0 100644
--- a/subworkflows/local/assemble/main.nf
+++ b/subworkflows/local/assemble/main.nf
@@ -1,223 +1,543 @@
-include { FLYE } from '../../../modules/nf-core/flye/main'
+include { FLYE as FLYE_ONT} from '../../../modules/nf-core/flye/main'
+include { FLYE as FLYE_HIFI} from '../../../modules/nf-core/flye/main'
include { HIFIASM } from '../../../modules/nf-core/hifiasm/main'
include { HIFIASM as HIFIASM_ONT } from '../../../modules/nf-core/hifiasm/main'
include { GFA_2_FA as GFA_2_FA_HIFI } from '../../../modules/local/gfa2fa/main'
include { GFA_2_FA as GFA_2_FA_ONT} from '../../../modules/local/gfa2fa/main'
include { MAP_TO_REF } from '../mapping/map_to_ref/main'
-include { RUN_LIFTOFF } from '../liftoff/main'
+include { LIFTOFF } from '../../../modules/nf-core/liftoff/main'
include { RAGTAG_PATCH } from '../../../modules/nf-core/ragtag/patch/main'
include { QC } from '../qc/main'
workflow ASSEMBLE {
take:
- ont_reads // meta, reads
- hifi_reads // meta, reads
- ch_input
- genome_size
+ ch_main
meryl_kmers
main:
- // Empty channels
- Channel.empty().set { ch_refs }
- Channel.empty().set { ch_ref_bam }
- Channel.empty().set { ch_assembly_bam }
- Channel.empty().set { ch_assembly }
- Channel.empty().set { flye_inputs }
- Channel.empty().set { hifiasm_inputs }
- Channel.empty().set { longreads }
- Channel.empty().set { ch_versions }
-
- if (params.use_ref) {
- ch_input
- .map { row -> [row.meta, row.ref_fasta] }
- .set { ch_refs }
- }
-
- if (params.skip_assembly) {
- // Sample sheet layout when skipping assembly
- // sample,ontreads,assembly,ref_fasta,ref_gff
- ch_input
- .map { row -> [row.meta, row.assembly] }
- .set { ch_assembly }
- }
- if (!params.skip_assembly) {
- def hifi_only = params.hifi && !params.ont ? true : false
- // Define inputs for flye
- if (params.assembler == "flye") {
- if (params.hifi) {
- hifi_reads
- .map { it -> [it[0], it[1]] }
- .set { flye_inputs }
- }
- if (params.ont) {
- ont_reads.set { flye_inputs }
- }
- // Run flye
- flye_inputs
- .join(genome_size)
- .map { meta, reads, genomesize -> [meta +[ genome_size: genomesize ], reads] }
- .set { flye_inputs }
- FLYE(flye_inputs, params.flye_mode)
- FLYE.out.fasta.map { meta, assembly -> [meta - meta.subMap('genome_size'), assembly] }.set { ch_assembly }
- ch_versions = ch_versions.mix(FLYE.out.versions)
- }
- if (params.assembler == "hifiasm") {
- // HiFi and ONT reads in ultralong mode
- if (params.hifi && params.ont) {
- hifi_reads
- .join(ont_reads)
- .set { hifiasm_inputs }
- HIFIASM(hifiasm_inputs, [[], [], []], [[], [], []], [[], []])
- GFA_2_FA_HIFI(HIFIASM.out.processed_unitigs)
- GFA_2_FA_HIFI.out.contigs_fasta.set { ch_assembly }
-
- ch_versions = ch_versions.mix(HIFIASM.out.versions).mix(GFA_2_FA_HIFI.out.versions)
- }
- // ONT reads only
- if (!params.hifi && params.ont) {
- ont_reads
- .map { meta, ontreads -> [meta, ontreads, []] }
- .set { hifiasm_inputs }
- HIFIASM_ONT(hifiasm_inputs, [[], [], []], [[], [], []], [[], []])
- GFA_2_FA_ONT(HIFIASM_ONT.out.processed_unitigs)
- GFA_2_FA_ONT.out.contigs_fasta.set { ch_assembly }
- ch_versions = ch_versions.mix(HIFIASM_ONT.out.versions).mix(GFA_2_FA_ONT.out.versions)
- }
- // HiFI reads only
- if (params.hifi && !params.ont) {
- hifi_reads
- .map { meta, ontreads -> [meta, ontreads, []] }
- .set { hifiasm_inputs }
- HIFIASM(hifiasm_inputs, [[], [], []], [[], [], []], [[], []])
+ /*
+ Samples are split into those that need assembly, and those that will not be assembled (i.e. assemblies are provided)
+ */
+ ch_main.dump(tag: "Assemble - Inputs")
- GFA_2_FA_HIFI(HIFIASM.out.processed_unitigs)
- GFA_2_FA_HIFI.out.contigs_fasta.set { ch_assembly }
+ ch_main
+ .branch {
+ it ->
+ to_assemble: !it.meta.assembly
+ no_assemble: it.meta.assembly
+ }
+ .set {
+ ch_main_branched
+ }
+ /*
+ There are three assembly strategies:
+ - Single: Using a single assembler with one type of reads
+ - Hybrid: Using a single assembler with both types of read in one run (only hifiasm --ul)
+ - Scaffold: Separately assembling ONT and HiFi reads, and then scaffolding one onto the other
- ch_versions = ch_versions.mix(HIFIASM.out.versions).mix(GFA_2_FA_HIFI.out.versions)
+ Each sample can only have one strategy, and branching happens here.
+ */
+ ch_main_branched
+ .to_assemble
+ .branch { it ->
+ single: it.meta.strategy == "single"
+ hybrid: it.meta.strategy == "hybrid"
+ scaffold: it.meta.strategy == "scaffold"
}
+ .set { ch_main_assemble_branched }
+
+ ch_main_assemble_branched
+ .single
+ .dump(tag: "Assemble: Branched: Single")
+ ch_main_assemble_branched
+ .hybrid
+ //.view {"Assemble: Hybrid: $it"}
+ .dump(tag: "Assemble: Branched: Hybrid")
+ ch_main_assemble_branched
+ .scaffold
+ .dump(tag: "Assemble: Branched: scaffold")
+
+ /*
+ =========================
+ FLYE ASSEMBLER
+ =========================
+ */
+ /*
+ Inputs for flye assembler:
+ - Samples with single strategy, where the assembler is flye
+ - Samples from the scaffold strategy where either (or both) assembler is flye
+ */
+
+ ch_main_assemble_branched
+ .single
+ .filter { it -> it.meta.assembler_ont == "flye" }
+ .mix(
+ // Add in the scaffolding samples where flye is used
+ ch_main_assemble_branched
+ .scaffold
+ .filter { it -> it.meta.assembler_ont == "flye" || it.meta.assembler_hifi == "flye" }
+ )
+ .set { ch_main_assemble_flye }
+
+ // Assembly flye branch
+ // Extra args per sample are stored in the meta map, so is the estimated / expected genome size
+ // The inputs are created once for ONT and once for HiFi
+ ch_main_assemble_flye
+ .filter { it -> it.meta.assembler_ont == "flye" && it.meta.ontreads }
+ .multiMap {
+ it ->
+ reads: [
+ it.meta,
+ it.meta.ontreads ?: [],
+ ]
+ mode: it.meta.assembler_ont == "flye" ? "--nano-hq" : null
}
- if (params.assembler == "flye_on_hifiasm" | params.assembler == "hifiasm_on_hifiasm") {
- // Run hifiasm
- hifi_reads
- .map { meta, hifireads -> [meta, hifireads, []] }
- .set { hifiasm_inputs }
- HIFIASM(hifiasm_inputs, [[], [], []], [[], [], []], [[], []])
-
- GFA_2_FA_HIFI(HIFIASM.out.processed_unitigs)
-
- ch_versions = ch_versions.mix(HIFIASM.out.versions).mix(GFA_2_FA_HIFI.out.versions)
-
- if(params.assembler == "flye_on_hifiasm") {
- // Run flye
- ont_reads
- .join(genome_size)
- .map { meta, reads, genomesize -> [[id: meta.id, genome_size: genomesize], reads]}
- .set { flye_inputs }
-
- FLYE(flye_inputs, params.flye_mode)
- FLYE.out.fasta
- .map { meta, assembly -> [[id: meta.id], assembly] }
- .join(
- GFA_2_FA_HIFI.out.contigs_fasta
- )
- .multiMap { meta, flye_fasta, hifiasm_fasta ->
- target: [meta, flye_fasta]
- query: [meta, hifiasm_fasta]
- }
- .set { ragtag_in }
- ch_versions = ch_versions.mix(FLYE.out.versions)
+ .set { flye_ont_inputs }
+
+ // These are the hifi samples
+ ch_main_assemble_flye
+ // Those where the hifi assembler is flye, or where there is only one assembler and only hifireads
+ .filter { it ->
+ it.meta.assembler_hifi == "flye" && it.meta.hifireads ||
+ (
+ it.meta.strategy == "single" &&
+ it.meta.hifireads &&
+ !it.meta.ontreads &&
+ it.meta.assembler == "flye"
+ )
+ }
+ .multiMap {
+ it ->
+ reads: [
+ it.meta,
+ it.meta.hifireads ?: [],
+ ]
+ mode: it.meta.assembler_hifi == "flye" ? "--pacbio-hifi" : null
+ }
+ .set { flye_hifi_inputs }
+
+ flye_ont_inputs.reads.dump(tag: "Assemble: Flye-ONT inputs")
+ flye_hifi_inputs.reads.dump(tag: "Assemble: Flye-HIFI inputs")
+
+ // Run through flye
+ FLYE_ONT(flye_ont_inputs.reads, flye_ont_inputs.mode)
+ FLYE_HIFI(flye_hifi_inputs.reads, flye_hifi_inputs.mode)
+
+ /*
+ =========================
+ HIFIASM ASSEMBLER
+ =========================
+ */
+ /* Hifiasm: everything that is not hifiasm-ONT
+ - Single branch with hifiasm as assembler and no ont reads (only hifireads)
+ - Hybrid assembly
+ - Scaffold samples where assembler_hifi (hifi assembler) is hifiasm
+ */
+ //ch_main_assemble_branched.hybrid.view {"ASSEMBLE: Branched: Hybrid"}
+ ch_main_assemble_branched
+ .single
+ .filter {
+ it -> it.meta.assembler_hifi == "hifiasm"
}
- if(params.assembler == "hifiasm_on_hifiasm") {
- // Run hifiasm --ont
- ont_reads
- .map { meta, ontreads -> [meta, ontreads, []] }
- .set { hifiasm_inputs }
- HIFIASM_ONT(hifiasm_inputs,[[], [], []], [[], [], []], [[], []])
- GFA_2_FA_ONT(HIFIASM_ONT.out.processed_unitigs)
- GFA_2_FA_ONT.out.contigs_fasta
- .join(
- GFA_2_FA_HIFI.out.contigs_fasta
- )
- .multiMap { meta, ont_assembly, hifi_assembly ->
- target: [meta, ont_assembly]
- query: [meta, hifi_assembly]
+ .mix(
+ ch_main_assemble_branched
+ .hybrid
+ .filter {
+ it -> it.meta.assembler_ont == "hifiasm"
}
- .set { ragtag_in }
- ch_versions = ch_versions.mix(HIFIASM_ONT.out.versions).mix(GFA_2_FA_ONT.out.versions)
- }
+ )
+ .mix(ch_main_assemble_branched
+ .scaffold
+ .filter {
+ it -> it.meta.assembler_hifi == "hifiasm"
+ }
+ )
+ .map {
+ it -> [
+ it.meta,
+ it.meta.hifireads,
+ // for hybrid samples include ONT reads in 3rd slot of first input (see hifiasm module)
+ (it.meta.strategy == "hybrid" && it.meta.ontreads) ? it.meta.ontreads : []
+ ]
+ }
+ .set { ch_main_assemble_hifi_hifiasm }
+
+ ch_main_assemble_hifi_hifiasm.dump(tag: "Assemble: hifiasm HIFI inputs")
+
+ //ch_main_assemble_hifi_hifiasm.view { "Assemble: hifiasm HIFI inputs: $it" }
+
+ HIFIASM(ch_main_assemble_hifi_hifiasm,
+ [[], [], []],
+ [[], [], []],
+ [[], []])
+
+ // hifiasm produces GFA files
+ GFA_2_FA_HIFI( HIFIASM.out.primary_contigs )
- RAGTAG_PATCH(ragtag_in.target, ragtag_in.query, [[], []], [[], []] )
- // takes: meta, assembly (ont), reference (hifi)
- RAGTAG_PATCH.out.patch_fasta.set { ch_assembly }
- ch_versions = ch_versions.mix(RAGTAG_PATCH.out.versions)
- }
- }
/*
- Prepare alignments
+ hifiasm with ONLY ont reads.
+ Assemble hifiasm_ont branch:
+ Single branch with hifiasm and only ont reads
+ Scaffold branch where assembler_ont (ont assembler) is hifiasm
*/
- if (params.skip_alignments) {
- // Sample sheet layout when skipping assembly and mapping
- // sample,ontreads,assembly,ref_fasta,ref_gff,assembly_bam,assembly_bai,ref_bam
- ch_input
- .map { row -> [row.meta, row.ref_bam] }
- .set { ch_ref_bam }
-
- ch_input
- .map { row -> [row.meta, row.assembly_bam] }
- .set { ch_assembly_bam }
- }
- else {
- Channel.empty().set { ch_ref_bam }
- if (params.assembler == "flye") {
- flye_inputs
- .map { meta, reads -> [[id: meta.id], reads] }
- .set { longreads }
- }
- if (params.assembler == "hifiasm" || params.assembler == "flye_on_hifiasm" || params.assembler == "hifiasm_on_hifiasm") {
- hifiasm_inputs
- .map { meta, long_reads, _ultralong -> [meta, long_reads] }
- .set { longreads }
- // When using either hifiasm_ont or flye_on_hifiasm, both reads are available, which should be used for qc?
- if (params.hifi && params.ont) {
- if (params.qc_reads == 'ONT') {
- ont_reads
- .map { it -> [it[0], it[1]] }
- .set { longreads }
- }
- if (params.qc_reads == 'HIFI') {
- hifi_reads
- .map { it -> [it[0], it[1]] }
- .set { longreads }
+
+ ch_main_assemble_branched
+ .single
+ .filter { it -> it.meta.assembler_ont == "hifiasm" && it.meta.ontreads }
+ .mix(ch_main_assemble_branched
+ .scaffold
+ .filter { it -> it.meta.assembler_ont == "hifiasm" }
+ )
+ .set { ch_main_assemble_ont_hifiasm }
+
+ ch_main_assemble_ont_hifiasm.dump(tag: "Assemble: hifiasm ONT inputs")
+
+ HIFIASM_ONT(ch_main_assemble_ont_hifiasm.map { it -> [ it.meta, it.meta.ontreads, [] ] }, [[], [], []], [[], [], []], [[], []])
+
+ GFA_2_FA_ONT( HIFIASM_ONT.out.primary_contigs)
+
+ // Flye:
+ FLYE_ONT.out.fasta
+ .filter {
+ meta, _fasta -> meta.strategy != "scaffold"
+ }
+ .map { meta_old, assembly -> [meta: meta_old + [ assembly: assembly ] ] }
+ .mix(
+ FLYE_HIFI.out.fasta
+ .filter {
+ meta, _fasta -> meta.strategy != "scaffold"
}
- }
+ .map { meta_old, assembly -> [meta: meta_old + [ assembly: assembly ] ] }
+ )
+ .set { flye_assemblies }
+
+ flye_assemblies.dump(tag: "Assemble: Flye assemblies")
+
+ // regernerate meta maps
+ GFA_2_FA_HIFI.out.contigs_fasta
+ .filter { it -> it[0].strategy != "scaffold" }
+ .map { meta_old, assembly ->
+ [
+ meta: meta_old +
+ // stick assembly into the correct key
+ [
+ assembly: (meta_old.strategy == "single" && meta_old.assembler_hifi == "hifiasm") || (meta_old.strategy == "hybrid" && meta_old.assembler_ont == "hifiasm") ? assembly : null,
+ ]
+ ]
}
+ .set { hifiasm_hifi_assemblies }
- if (params.quast) {
- if (params.use_ref) {
- MAP_TO_REF(longreads, ch_refs)
+ hifiasm_hifi_assemblies.dump(tag: "Assemble: hifiasm HIFI assemblies")
- MAP_TO_REF.out.ch_aln_to_ref_bam.set { ch_ref_bam }
- }
+ GFA_2_FA_ONT.out.contigs_fasta
+ .filter { meta, _fasta -> meta.strategy != "scaffold" }
+ .map { meta, assembly ->
+ [
+ meta: meta +
+ [
+ assembly: assembly
+ ]
+ ]
}
- }
+ .set { hifiasm_ont_assemblies }
+
+ hifiasm_ont_assemblies.dump(tag: "Assemble: hifiasm ONT assemblies")
+
/*
- QC on initial assembly
+ =========================
+ SCAFFOLDING
+ =========================
*/
- QC(ch_input, longreads, ch_assembly, ch_ref_bam, meryl_kmers)
- ch_versions = ch_versions.mix(QC.out.versions)
- if (params.lift_annotations) {
- RUN_LIFTOFF(ch_assembly, ch_input)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
+ // The single and hybrid channels can be mixed and forwarded.
+
+ flye_assemblies
+ .mix(hifiasm_hifi_assemblies)
+ .mix(hifiasm_ont_assemblies)
+ .set { ch_assemblies_no_scaffold }
+
+ ch_assemblies_no_scaffold.dump(tag: "Assemble: Assemblies without scaffolding")
+
+
+ /*
+ -------------------
+ Prepare Scaffolding
+ -------------------
+ */
+ // This leaves the scaffold strategy.
+ // scaffolds can be: FLYE-HIFIASM, FLYE-FLYE, HIFIASM-HIFIASM or HIFIASM-FLYE
+ // The above is (ONT-HIFI)
+
+ FLYE_ONT.out.fasta
+ // Flye-hifiasm
+ .filter { meta, _fasta ->
+ meta.strategy == "scaffold" &&
+ meta.assembler_ont == "flye" &&
+ meta.assembler_hifi == "hifiasm"
+ }
+ .map { meta, fasta -> [meta.id, meta, fasta] }
+ .join(
+ GFA_2_FA_HIFI
+ .out
+ .contigs_fasta
+ .filter { meta, _fasta ->
+ meta.strategy == "scaffold" &&
+ meta.assembler_ont == "flye" &&
+ meta.assembler_hifi == "hifiasm"
+ }
+ .map { meta, fasta -> [ meta.id, fasta ] }
+ )
+ .map { _id, meta_old, assembly_flye, assembly_hifiasm ->
+ [
+ meta: meta_old -
+ meta_old.subMap("hifiasm_assembly", "assembly_hifi", "assembly_ont", "flye_assembly") +
+ [
+ assembly_ont: assembly_flye,
+ assembly_hifi: assembly_hifiasm
+ ]
+ ]
+ }
+ .set{ scaffold_flye_hifiasm }
+
+ // flye-flye
+ FLYE_ONT.out.fasta
+ .filter {
+ meta, _fasta -> meta.strategy == "scaffold" && meta.assembler_ont == "flye" & meta.assembler_hifi == "flye"
+ }
+ .map {
+ meta, fasta -> [meta.id, meta, fasta] // id, meta, ont assembly
+ }
+ .join(
+ FLYE_HIFI.out.fasta
+ .filter {
+ meta, _fasta -> meta.strategy == "scaffold" && meta.assembler_ont == "flye" & meta.assembler_hifi == "flye"
+ }
+ .map {
+ meta, fasta -> [ meta.id, fasta ] // id, hifi assembly
+ },
+ )
+ .map { _id, meta, ont_assembly, hifi_assembly ->
+ [
+ meta: meta +
+ [
+ assembly_ont: ont_assembly,
+ assembly_hifi: hifi_assembly
+ ]
+ ]
+ }
+ .set { scaffold_flye_flye }
+
+ // hifiasm_flye
+ GFA_2_FA_ONT.out.contigs_fasta
+ .filter {
+ meta, _assembly -> meta.strategy == "scaffold" &&
+ meta.assembler_ont == "hifiasm" &&
+ meta.assembler_hifi == "flye"
+ }
+ .map {
+ meta, assembly ->
+ [
+ meta.id,
+ meta,
+ assembly
+ ]
+ }
+ .join(
+ FLYE_HIFI.out.fasta
+ .filter{ meta, _fasta -> meta.strategy == "scaffold" && meta.assembler_ont == "hifiasm" && meta.assembler_hifi == "flye" }
+ .map { meta, fasta -> [ meta.id, fasta ] }
+ )
+ .map {
+ _id, meta, hifiasm_ont_assembly, flye_hifi_assembly ->
+ [
+ meta: meta +
+ [
+ assembly_ont: hifiasm_ont_assembly,
+ assembly_hifi: flye_hifi_assembly
+ ]
+ ]
+ }
+ .set{ scaffold_hifiasm_flye }
+
+ // hifiasm_hifiasm
+ GFA_2_FA_ONT.out.contigs_fasta
+ .filter {
+ meta, _assembly -> meta.strategy == "scaffold" &&
+ meta.assembler_ont == "hifiasm" &&
+ meta.assembler_hifi == "hifiasm"
+ }
+ .map {
+ meta, assembly ->
+ [
+ meta.id,
+ meta,
+ assembly
+ ]
+ }
+ .join(
+ GFA_2_FA_HIFI.out.contigs_fasta
+ .filter {
+ meta, _assembly -> meta.strategy == "scaffold" &&
+ meta.assembler_ont == "hifiasm" &&
+ meta.assembler_hifi == "hifiasm"
+ }
+ .map {
+ meta, assembly ->
+ [
+ meta.id,
+ assembly
+ ]
+ }
+ )
+ .map {
+ _id, meta, assembly_ont, assembly_hifi ->
+ [
+ meta: meta +
+ [
+ assembly_ont: assembly_ont,
+ assembly_hifi: assembly_hifi
+ ]
+ ]
+ }
+ .set{ scaffold_hifiasm_hifiasm }
+
+ // branch to scaffold those assemblies that need it
+
+ scaffold_flye_hifiasm
+ .mix(scaffold_flye_flye)
+ .mix(scaffold_hifiasm_flye)
+ .mix(scaffold_hifiasm_hifiasm)
+ .set { ch_to_scaffold }
+
+ ch_to_scaffold.dump(tag: "Assemble: Assemblies with scaffolding - inputs")
+
+ // For scaffolding, depeding on which strategy used, the correct assembly needs to go into either target or query:
+ // assembly_ont is always ONT, assembly_hifi is always HiFi
+
+ ch_to_scaffold
+ .multiMap {
+ it ->
+ target: [
+ it.meta,
+ it.meta.assembly_scaffolding_order == "ont_on_hifi" ? (it.meta.assembly_ont) : (it.meta.assembly_hifi)
+ ]
+ query: [
+ it.meta,
+ it.meta.assembly_scaffolding_order == "ont_on_hifi" ? (it.meta.assembly_hifi) : (it.meta.assembly_ont)
+ ]
+ }
+ .set { ragtag_in }
+
+ ragtag_in.target.dump(tag: "ASSEMBLE: SCAFFOLD: RAGTAG_PATCH INPUT: TARGET")
+ ragtag_in.query.dump( tag: "ASSEMBLE: SCAFFOLD: RAGTAG_PATCH INPUT: QUERY")
+ // Scaffold with PATCH
+ RAGTAG_PATCH(ragtag_in.target, ragtag_in.query, [[], []], [[], []] )
+
+ // Update meta
+ RAGTAG_PATCH.out.patch_fasta
+ .map { meta, patched -> [meta: meta + [assembly: patched] ] }
+ .set { ch_assemblies_scaffold }
+
+ ch_assemblies_scaffold.dump(tag: "Assemble: Assemblies with scaffolding - outputs")
+
+ // Mix everything assembled back togehter
+ ch_assemblies_no_scaffold
+ .mix(ch_assemblies_scaffold)
+ .set { ch_main_assembled }
+
+ ch_main_assembled.dump(tag: "Assemble: Assembled")
+
+ // Mix with whatever was not destined for assembly
+ ch_main_branched
+ .no_assemble
+ .mix( ch_main_assembled )
+ .set { ch_main_to_mapping }
+
+ ch_main_to_mapping.dump(tag: "Assemble: TO MAPPING")
+
+ // QUAST is the only QC tool that requires mapping
+
+ ch_main_to_mapping
+ .branch {
+ it ->
+ quast: it.meta.quast
+ no_quast: !it.meta.quast
+ }
+ // Note that this channel is set here but only the quast branch is further used
+ .set { ch_main_quast_branch }
+
+ // If QUAST should run, and we need an alignment to reference, this is created here
+ ch_main_quast_branch
+ .quast
+ .branch {
+ it ->
+ use_ref: it.meta.use_ref
+ no_use_ref: !it.meta.use_ref
+ }
+ .set {
+ ch_quast_branched
+ }
+
+ // Alignment is actually only created if no bam file is provided
+ ch_quast_branched
+ .use_ref
+ .branch { it ->
+ to_map: !it.meta.ref_map_bam
+ dont_map: it.meta.ref_map_bam
+ }
+ .set { ch_ref_mapping_branched }
+
+ // Use the QC reads and map them to ref
+ ch_ref_mapping_branched
+ .to_map
+ .map {
+ it ->
+ [ it.meta, it.meta.qc_reads_path, it.meta.ref_fasta ]
+ }
+ .set { map_to_ref_in }
+
+ MAP_TO_REF(map_to_ref_in)
+
+ // Add the ref mapping to the large main channel
+ MAP_TO_REF.out.ch_aln_to_ref_bam
+ .map { meta, bam -> [ meta: meta + [ref_map_bam: bam] ] }
+ .mix(ch_ref_mapping_branched.dont_map)
+ .mix(ch_quast_branched.no_use_ref)
+ // above recreates ch_main_quast_branch.quast
+ .mix(ch_main_quast_branch.no_quast)
+ .set { ch_main_to_qc }
+
+ ch_main_to_qc.dump(tag: "ASSEMBLE: QC INPUT")
+ //QC on initial assembly
+
+ // scaffolds to QC need to be defined here, this is what is in the assembly slot
+ ch_main_to_qc
+ .map { it -> [it.meta.id, it.meta.assembly] }
+ .set { scaffolds }
+
+ QC(ch_main_to_qc, scaffolds, meryl_kmers)
+
+ // If annotation liftover on the initial assembly is desired, it happens here.
+ ch_main_to_qc
+ .filter {
+ it -> it.meta.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.assembly,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+ liftoff_in.dump(tag: "ASSEMBLE: LIFTOFF: INPUT")
+ LIFTOFF(liftoff_in, [])
emit:
- assembly = ch_assembly
- ref_bam = ch_ref_bam
- longreads
+ ch_main = ch_main_to_qc
assembly_quast_reports = QC.out.quast_out
assembly_busco_reports = QC.out.busco_out
assembly_merqury_reports = QC.out.merqury_report_files
- versions = ch_versions
}
diff --git a/subworkflows/local/bam_sort_stat/main.nf b/subworkflows/local/bam_sort_stat/main.nf
index 89f8cdf4..826d36a7 100644
--- a/subworkflows/local/bam_sort_stat/main.nf
+++ b/subworkflows/local/bam_sort_stat/main.nf
@@ -17,18 +17,13 @@ workflow BAM_INDEX_STATS_SAMTOOLS {
fasta
main:
- Channel.empty().set { ch_versions }
-
SAMTOOLS_INDEX(bam)
- BAM_STATS_SAMTOOLS(bam.join(SAMTOOLS_INDEX.out.bai, by: [0]), fasta)
-
- versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions).mix(BAM_STATS_SAMTOOLS.out.versions)
+ BAM_STATS_SAMTOOLS(bam.join(SAMTOOLS_INDEX.out.csi, by: [0]), fasta)
emit:
- bai = SAMTOOLS_INDEX.out.bai // channel: [ val(meta), [ bai ] ]
+ bai = SAMTOOLS_INDEX.out.csi // channel: [ val(meta), [ csi ] ]
stats = BAM_STATS_SAMTOOLS.out.stats // channel: [ val(meta), [ stats ] ]
flagstat = BAM_STATS_SAMTOOLS.out.flagstat // channel: [ val(meta), [ flagstat ] ]
idxstats = BAM_STATS_SAMTOOLS.out.idxstats // channel: [ val(meta), [ idxstats ] ]
- versions
}
diff --git a/subworkflows/local/hifi/main.nf b/subworkflows/local/hifi/main.nf
deleted file mode 100644
index ea2fd032..00000000
--- a/subworkflows/local/hifi/main.nf
+++ /dev/null
@@ -1,22 +0,0 @@
-include { PREPARE_HIFI } from '../prepare_hifi/main'
-
-
-workflow HIFI {
- take:
- inputs
-
- main:
- Channel.empty().set { ch_versions }
-
- PREPARE_HIFI(inputs)
-
- PREPARE_HIFI.out.hifireads.set { hifi_reads }
-
- ch_versions.mix(PREPARE_HIFI.out.versions)
-
- versions = ch_versions
-
- emit:
- hifi_reads
- versions
-}
diff --git a/subworkflows/local/jellyfish/main.nf b/subworkflows/local/jellyfish/main.nf
deleted file mode 100644
index e1257b58..00000000
--- a/subworkflows/local/jellyfish/main.nf
+++ /dev/null
@@ -1,57 +0,0 @@
-include { COUNT } from '../../../modules/local/jellyfish/count/main'
-include { DUMP } from '../../../modules/local/jellyfish/dump/main'
-include { HISTO } from '../../../modules/local/jellyfish/histo/main'
-include { STATS } from '../../../modules/local/jellyfish/stats/main'
-include { GENOMESCOPE } from '../../../modules/local/genomescope/main'
-
-workflow JELLYFISH {
- take:
- samples // id, fasta
- nanoq_out
-
- main:
- Channel.empty().set { genomescope_in }
- Channel.empty().set { ch_versions }
- COUNT(samples)
- COUNT.out.kmers.set { kmers }
-
- ch_versions = ch_versions.mix(COUNT.out.versions)
-
- if (params.dump) {
- DUMP(kmers)
- ch_versions = ch_versions.mix(DUMP.out.versions)
- }
-
- HISTO(kmers)
- ch_versions = ch_versions.mix(HISTO.out.versions)
-
- if (!params.read_length == null) {
- HISTO.out.histo.map { it -> [it[0], it[1], params.kmer_length, params.read_length] }.set { genomescope_in }
- }
-
- if (params.read_length == null) {
- HISTO.out.histo.map { it -> [it[0], it[1], params.kmer_length] }.join(nanoq_out).set { genomescope_in }
- }
-
- GENOMESCOPE(genomescope_in)
-
- ch_versions = ch_versions.mix(GENOMESCOPE.out.versions)
-
- STATS(kmers)
-
- ch_versions = ch_versions.mix(STATS.out.versions)
-
- GENOMESCOPE.out.estimated_hap_len.set { hap_len }
-
- GENOMESCOPE.out.summary.set { genomescope_summary }
-
- GENOMESCOPE.out.plot.set { genomescope_plot }
-
- versions = ch_versions
-
- emit:
- hap_len
- genomescope_summary
- genomescope_plot
- versions
-}
diff --git a/subworkflows/local/liftoff/main.nf b/subworkflows/local/liftoff/main.nf
index 7d2fd024..baee9e18 100644
--- a/subworkflows/local/liftoff/main.nf
+++ b/subworkflows/local/liftoff/main.nf
@@ -2,23 +2,13 @@ include { LIFTOFF } from '../../../modules/nf-core/liftoff/main'
workflow RUN_LIFTOFF {
take:
- assembly
- inputs
+ liftoff_in
main:
- Channel.empty().set { ch_versions }
- assembly
- .join(
- inputs.map { row -> [row.meta, row.ref_fasta, row.ref_gff] }
- )
- .set { liftoff_in }
-
LIFTOFF(liftoff_in, [])
LIFTOFF.out.gff3.set { lifted_annotations }
- versions = ch_versions.mix(LIFTOFF.out.versions)
emit:
lifted_annotations
- versions
}
diff --git a/subworkflows/local/mapping/map_sr/main.nf b/subworkflows/local/mapping/map_sr/main.nf
index 838d7454..e29204c2 100644
--- a/subworkflows/local/mapping/map_sr/main.nf
+++ b/subworkflows/local/mapping/map_sr/main.nf
@@ -7,17 +7,13 @@ workflow MAP_SR {
genome_assembly
main:
- Channel.empty().set { ch_versions }
// map reads to assembly
in_reads
- .map { meta, reads -> [[id: meta.id], reads] }
.join(genome_assembly)
.set { map_assembly }
ALIGN_SHORT(map_assembly, true, 'bai', false, false)
- versions = ch_versions.mix(ALIGN_SHORT.out.versions)
-
ALIGN_SHORT.out.bam.set { aln_to_assembly_bam }
ALIGN_SHORT.out.index.set { aln_to_assembly_bai }
@@ -32,8 +28,6 @@ workflow MAP_SR {
BAM_STATS(aln_to_assembly_bam_bai, ch_fasta)
- versions = ch_versions.mix(BAM_STATS.out.versions)
-
aln_to_assembly_bam
.join(aln_to_assembly_bai)
.set { aln_to_assembly_bam_bai }
@@ -42,5 +36,4 @@ workflow MAP_SR {
aln_to_assembly_bam
aln_to_assembly_bai
aln_to_assembly_bam_bai
- versions
}
diff --git a/subworkflows/local/mapping/map_to_assembly/main.nf b/subworkflows/local/mapping/map_to_assembly/main.nf
index 2489a8ed..47c31897 100644
--- a/subworkflows/local/mapping/map_to_assembly/main.nf
+++ b/subworkflows/local/mapping/map_to_assembly/main.nf
@@ -3,20 +3,16 @@ include { BAM_STATS_SAMTOOLS as BAM_STATS } from '../../../nf-core/bam_stats_sam
workflow MAP_TO_ASSEMBLY {
take:
- in_reads
- genome_assembly
+ map_assembly // meta: [id, qc_reads], reads, refs
main:
- Channel.empty().set { ch_versions }
- // map reads to assembly
- in_reads
- .join(genome_assembly)
- .set { map_assembly }
-
ALIGN(map_assembly, true, 'bai', false, false)
- ALIGN.out.bam.set { aln_to_assembly_bam }
- ALIGN.out.index.set { aln_to_assembly_bai }
+ ALIGN.out.bam
+ .set { aln_to_assembly_bam }
+
+ ALIGN.out.index
+ .set { aln_to_assembly_bai }
map_assembly
.map { meta, _reads, fasta -> [meta, fasta] }
@@ -28,9 +24,6 @@ workflow MAP_TO_ASSEMBLY {
BAM_STATS(aln_to_assembly_bam_bai, ch_fasta )
- versions = ch_versions.mix(ALIGN.out.versions).mix(BAM_STATS.out.versions)
-
emit:
- aln_to_assembly_bam
- versions
+ aln_to_assembly_bam // [id], bam
}
diff --git a/subworkflows/local/mapping/map_to_ref/main.nf b/subworkflows/local/mapping/map_to_ref/main.nf
index 2293e4b8..d97df25d 100644
--- a/subworkflows/local/mapping/map_to_ref/main.nf
+++ b/subworkflows/local/mapping/map_to_ref/main.nf
@@ -3,33 +3,28 @@ include { BAM_STATS_SAMTOOLS as BAM_STATS } from '../../../nf-core/bam_stats_sam
workflow MAP_TO_REF {
take:
- in_reads
- ch_refs
+ ch_map_ref // meta, reads, refs
main:
- Channel.empty().set { ch_versions }
// Map reads to reference
- in_reads
- .join(ch_refs)
- .set { ch_map_ref_in }
+ ALIGN(ch_map_ref, true, 'bai', false, false)
- ALIGN(ch_map_ref_in, true, 'bai', false, false)
+ ALIGN.out.bam
+ .set { ch_aln_to_ref_bam }
- ALIGN.out.bam.set { ch_aln_to_ref_bam }
+ ALIGN.out.index
+ .set { aln_to_ref_bai }
ch_aln_to_ref_bam
- .join(ALIGN.out.index)
+ .join(aln_to_ref_bai)
.set { ch_aln_to_ref_bam_bai }
- ch_map_ref_in
- .map { meta, _reads, fasta -> [meta, fasta] }
+ ch_map_ref
+ .map { meta, _reads, fasta -> [[meta], fasta] }
.set { ch_fasta }
BAM_STATS(ch_aln_to_ref_bam_bai, ch_fasta)
- versions = ch_versions.mix(ALIGN.out.versions).mix(BAM_STATS.out.versions)
-
emit:
- ch_aln_to_ref_bam
- versions
+ ch_aln_to_ref_bam // meta, bam
}
diff --git a/subworkflows/local/ont/main.nf b/subworkflows/local/ont/main.nf
deleted file mode 100644
index 5f079840..00000000
--- a/subworkflows/local/ont/main.nf
+++ /dev/null
@@ -1,45 +0,0 @@
-include { PREPARE_ONT } from '../prepare_ont/main'
-include { JELLYFISH } from '../jellyfish/main'
-
-workflow ONT {
- take:
- input_channel
- genome_size
-
- main:
- Channel.empty().set { ch_versions }
- Channel.of([[],[]])
- .tap { genomescope_summary }
- .tap { genomescope_plot }
-
- PREPARE_ONT(input_channel)
-
- PREPARE_ONT.out.trimmed.set { ont_reads }
-
- PREPARE_ONT.out.nanoq_report.set { nanoq_report }
-
- PREPARE_ONT.out.nanoq_stats.set { nanoq_stats }
-
- ch_versions = ch_versions.mix(PREPARE_ONT.out.versions)
-
- if (params.jellyfish) {
- JELLYFISH(PREPARE_ONT.out.trimmed, PREPARE_ONT.out.med_len)
- if (params.genome_size == null) {
- JELLYFISH.out.hap_len.set { genome_size }
- }
- JELLYFISH.out.genomescope_summary.set { genomescope_summary }
- JELLYFISH.out.genomescope_plot.set { genomescope_plot }
- ch_versions = ch_versions.mix(JELLYFISH.out.versions)
- }
-
- versions = ch_versions
-
- emit:
- ont_reads
- genome_size
- nanoq_report
- nanoq_stats
- genomescope_plot
- genomescope_summary
- versions
-}
diff --git a/subworkflows/local/polishing/dorado/main.nf b/subworkflows/local/polishing/dorado/main.nf
new file mode 100644
index 00000000..be3663d2
--- /dev/null
+++ b/subworkflows/local/polishing/dorado/main.nf
@@ -0,0 +1,59 @@
+include { DORADO_ALIGNER as ALIGN } from '../../../../modules/local/dorado/aligner/main.nf'
+include { DORADO_POLISH as POLISH } from '../../../../modules/local/dorado/polish/main.nf'
+include { QC } from '../../qc/main.nf'
+include { LIFTOFF } from '../../../../modules/nf-core/liftoff/main'
+
+workflow POLISH_DORADO {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+
+ ch_main
+ .map { it -> [it.meta, it.meta.assembly, it.meta.ontreads] }
+ .set { ch_aln_in }
+
+ ALIGN(ch_aln_in)
+
+ ALIGN.out.bam
+ .join(ALIGN.out.bai)
+ .map {meta, bam, bai-> [ meta, meta.assembly, bam, bai ] }
+ .set { ch_polish_in }
+
+ POLISH(ch_polish_in, [])
+
+ POLISH.out.polished_alignment.set { polished_assembly }
+
+ polished_assembly
+ .map { meta, polished_dorado -> [meta: meta + [ polished: [polished_dorado: polished_dorado ] ] ]}
+ .set { ch_main_out }
+
+ QC(
+ ch_main_out.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [ assembly_map_bam: null] ] },
+ polished_assembly.map { meta, polished -> [meta.id, polished] },
+ meryl_kmers
+ )
+
+ ch_main_out
+ .filter {
+ it -> it.meta.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.polished.dorado,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in, [])
+
+ emit:
+ ch_main = ch_main_out
+ quast_out = QC.out.quast_out
+ busco_out = QC.out.busco_out
+ merqury_report_files = QC.out.merqury_report_files
+}
diff --git a/subworkflows/local/polishing/main.nf b/subworkflows/local/polishing/main.nf
index 1c5a4dd9..a42c5d2f 100644
--- a/subworkflows/local/polishing/main.nf
+++ b/subworkflows/local/polishing/main.nf
@@ -1,81 +1,89 @@
-include { POLISH_MEDAKA } from './medaka/polish_medaka/main'
-include { POLISH_PILON } from './pilon/polish_pilon/main'
+include { POLISH_MEDAKA } from './medaka/polish_medaka/main.nf'
+include { POLISH_PILON } from './pilon/polish_pilon/main.nf'
+include { POLISH_DORADO } from './dorado/main.nf'
workflow POLISH {
take:
- inputs
- ch_ont_reads
- ch_longreads
- ch_shortreads
- ch_polished_genome
- reference_bam
+ ch_main
meryl_kmers
main:
+ channel.empty().set { polish_busco_reports }
+ channel.empty().set { polish_quast_reports }
+ channel.empty().set { polish_merqury_reports }
+
+ ch_main
+ .branch { it ->
+ def medaka_polishers = ["medaka","medaka+pilon"]
+ def dorado_polishers = ["dorado","dorado+pilon"]
+ medaka: medaka_polishers.contains(it.meta.polish)
+ dorado: dorado_polishers.contains(it.meta.polish)
+ no_ont_polish: !medaka_polishers.contains(it.meta.polish) && !dorado_polishers.contains(it.meta.polish)
+ }
+ .set { ch_main_polish }
- Channel.empty().set { ch_versions }
- Channel.empty().set { polish_busco_reports }
- Channel.empty().set { polish_quast_reports }
- Channel.empty().set { polish_merqury_reports }
+ POLISH_MEDAKA(ch_main_polish.medaka, meryl_kmers)
- if (params.polish_medaka) {
+ POLISH_DORADO(ch_main_polish.dorado, meryl_kmers)
- if (params.hifiasm_ont) {
- error('Medaka should not be used on ONT-HiFi hybrid assemblies')
- }
- if (params.hifi && !params.ont) {
- error('Medaka should not be used on HiFi assemblies')
- }
+ POLISH_MEDAKA.out.busco_out
+ .mix(POLISH_DORADO.out.busco_out)
+ .set { polish_busco_reports }
- POLISH_MEDAKA(inputs, ch_ont_reads, ch_polished_genome, reference_bam, meryl_kmers)
+ POLISH_MEDAKA.out.quast_out
+ .mix(POLISH_DORADO.out.quast_out)
+ .set { polish_quast_reports }
- POLISH_MEDAKA.out.polished_assembly.set { ch_polished_genome }
+ POLISH_MEDAKA.out.merqury_report_files
+ .mix(POLISH_DORADO.out.merqury_report_files)
+ .set { polish_merqury_reports }
- POLISH_MEDAKA.out.busco_out.set { polish_busco_reports }
+ POLISH_MEDAKA.out.ch_main
+ .mix(POLISH_DORADO.out.ch_main)
+ .mix(ch_main_polish.no_ont_polish)
+ .set { ch_main_polish_pilon }
- POLISH_MEDAKA.out.quast_out.set { polish_quast_reports }
- POLISH_MEDAKA.out.merqury_report_files.set { polish_merqury_reports }
-
- ch_versions = ch_versions.mix(POLISH_MEDAKA.out.versions)
- }
/*
Polishing with short reads using pilon
*/
- if (params.polish_pilon) {
- POLISH_PILON(inputs, ch_shortreads, ch_longreads, ch_polished_genome, reference_bam, meryl_kmers)
-
- POLISH_PILON.out.pilon_polished.set { ch_polished_genome }
+ ch_main_polish_pilon
+ .branch {
+ it ->
+ def pilon_polishers = ["pilon","medaka+pilon", "dorado+pilon"]
+ pilon: pilon_polishers.contains(it.meta.polish)
+ no_pilon: true
+ }
+ .set { ch_main_polish_pilon_in }
- polish_busco_reports
- .concat(
- POLISH_PILON.out.busco_out
- )
- .set { polish_busco_reports }
+ POLISH_PILON(ch_main_polish_pilon_in.pilon, meryl_kmers)
- polish_quast_reports
- .concat(
- POLISH_PILON.out.quast_out
- )
- .set { polish_quast_reports }
+ ch_main_polish_pilon_in.no_pilon.mix(POLISH_PILON.out.ch_main)
+ .set { ch_out }
- polish_merqury_reports
- .concat(
- POLISH_PILON.out.merqury_report_files
- )
- .set { polish_merqury_reports }
+ polish_busco_reports
+ .concat(
+ POLISH_PILON.out.busco_out
+ )
+ .set { polish_busco_reports }
- ch_versions = ch_versions.mix(POLISH_PILON.out.versions)
- }
+ polish_quast_reports
+ .concat(
+ POLISH_PILON.out.quast_out
+ )
+ .set { polish_quast_reports }
- versions = ch_versions
+ polish_merqury_reports
+ .concat(
+ POLISH_PILON.out.merqury_report_files
+ )
+ .set { polish_merqury_reports }
emit:
- ch_polished_genome
+ ch_main = ch_out
polish_busco_reports
polish_quast_reports
polish_merqury_reports
- versions
}
diff --git a/subworkflows/local/polishing/medaka/polish_medaka/main.nf b/subworkflows/local/polishing/medaka/polish_medaka/main.nf
index e4d459fa..d11228fa 100644
--- a/subworkflows/local/polishing/medaka/polish_medaka/main.nf
+++ b/subworkflows/local/polishing/medaka/polish_medaka/main.nf
@@ -1,41 +1,61 @@
-include { RUN_MEDAKA } from '../run_medaka/main'
+include { MEDAKA_PARALLEL as MEDAKA } from '../../../../../modules/local/medaka/medaka_consensus/main'
include { QC } from '../../../qc/main.nf'
-include { RUN_LIFTOFF } from '../../../liftoff/main'
+include { LIFTOFF } from '../../../../../modules/nf-core/liftoff/main'
workflow POLISH_MEDAKA {
take:
- ch_input
- in_reads
- assembly
- ch_aln_to_ref
+ ch_main
meryl_kmers
main:
- Channel.empty().set { ch_versions }
- Channel.empty().set { quast_out }
- Channel.empty().set { busco_out }
- Channel.empty().set { merqury_report_files }
+ channel.empty().set { ch_versions }
- RUN_MEDAKA(in_reads, assembly)
- RUN_MEDAKA.out.medaka_out.set { polished_assembly }
+ ch_main
+ .map {
+ it ->
+ [ it.meta, it.meta.ontreads, it.meta.assembly ]
- ch_versions = ch_versions.mix(RUN_MEDAKA.out.versions)
+ }
+ .set { ch_medaka_in }
- QC(ch_input, in_reads, polished_assembly, ch_aln_to_ref, meryl_kmers)
+ MEDAKA(ch_medaka_in)
- ch_versions = ch_versions.mix(QC.out.versions)
+ MEDAKA.out.assembly.set { polished_assembly }
- if (params.lift_annotations) {
- RUN_LIFTOFF(polished_assembly, ch_input)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
-
- versions = ch_versions
+ polished_assembly
+ .map { meta, polished_medaka -> [meta: meta + [ polished: [medaka: polished_medaka ] ] ]}
+ // After joining re-create the maps from the stored map
+ .set { ch_medaka_out }
+
+ ch_medaka_out
+ .set { ch_main_out }
+
+ QC(
+ ch_medaka_out.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [ assembly_map_bam: null] ] },
+ polished_assembly.map { meta, polished -> [meta.id, polished] },
+ meryl_kmers
+ )
+
+
+ ch_medaka_out
+ .filter {
+ it -> it.meta.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.polished.medaka,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in, [])
emit:
- polished_assembly
+ ch_main = ch_main_out
quast_out = QC.out.quast_out
busco_out = QC.out.busco_out
merqury_report_files = QC.out.merqury_report_files
- versions
}
diff --git a/subworkflows/local/polishing/medaka/run_medaka/main.nf b/subworkflows/local/polishing/medaka/run_medaka/main.nf
deleted file mode 100644
index 2ba3ceb6..00000000
--- a/subworkflows/local/polishing/medaka/run_medaka/main.nf
+++ /dev/null
@@ -1,22 +0,0 @@
-include { MEDAKA_PARALLEL as MEDAKA } from '../../../../../modules/local/medaka/medaka_consensus/main'
-
-workflow RUN_MEDAKA {
- take:
- in_reads
- assembly
-
- main:
-
- in_reads
- .join(assembly)
- .set { medaka_in }
-
- MEDAKA(medaka_in)
-
- MEDAKA.out.assembly.set { medaka_out }
- MEDAKA.out.versions.set { versions }
-
- emit:
- medaka_out
- versions
-}
diff --git a/subworkflows/local/polishing/pilon/polish_pilon/main.nf b/subworkflows/local/polishing/pilon/polish_pilon/main.nf
index 3b7df47a..cf33f62e 100644
--- a/subworkflows/local/polishing/pilon/polish_pilon/main.nf
+++ b/subworkflows/local/polishing/pilon/polish_pilon/main.nf
@@ -1,45 +1,77 @@
-include { RUN_PILON } from '../run_pilon/main'
+include { PILON } from '../../../../../modules/nf-core/pilon/main'
include { MAP_SR } from '../../../mapping/map_sr/main'
-include { RUN_LIFTOFF } from '../../../liftoff/main'
+include { LIFTOFF } from '../../../../../modules/nf-core/liftoff/main'
include { QC } from '../../../qc/main.nf'
workflow POLISH_PILON {
take:
- ch_input
- shortreads
- in_reads
- assembly
- ch_aln_to_ref
+ ch_main
meryl_kmers
main:
- Channel.empty().set { ch_versions }
+ channel.empty().set { ch_versions }
- MAP_SR(shortreads, assembly)
+ ch_main
+ .multiMap {
+ it ->
+ shortreads: [it.meta, it.meta.shortreads]
+ assembly: [
+ it.meta,
+ it.meta.polish == "medaka+pilon" ? it.meta.polished.medaka : it.meta.polish == "dorado+pilon" ? it.meta.polished.dorado : it.meta.assembly
+ ]
+ }
+ .set { map_sr_in }
- ch_versions = ch_versions.mix(MAP_SR.out.versions)
+ //map_sr_in.shortreads.view {"POLISH_PILON: map_sr_in.shortreads: $it"}
+ //map_sr_in.assembly.view {"POLISH_PILON: map_sr_in.assembly: $it"}
- RUN_PILON(assembly, MAP_SR.out.aln_to_assembly_bam_bai)
+ MAP_SR(map_sr_in.shortreads, map_sr_in.assembly)
- RUN_PILON.out.improved_assembly.set { pilon_polished }
- ch_versions = ch_versions.mix(RUN_PILON.out.versions)
+ map_sr_in.assembly
+ .join(MAP_SR.out.aln_to_assembly_bam_bai)
+ .multiMap {
+ meta, assembly, bam, bai ->
+ assembly: [meta, assembly]
+ bam_bai: [meta, bam, bai]
+ }
+ .set { pilon_in }
- QC(ch_input, in_reads, pilon_polished, ch_aln_to_ref, meryl_kmers)
+ PILON(
+ pilon_in.assembly,
+ pilon_in.bam_bai,
+ "bam",
+ )
- ch_versions = ch_versions.mix(QC.out.versions)
+ pilon_polished = PILON.out.improved_assembly
- if (params.lift_annotations) {
- RUN_LIFTOFF(pilon_polished, ch_input)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
+ pilon_polished
+ .map { meta, polished_pilon -> [ meta: meta + [ polished: [pilon: polished_pilon] ] ] }
+ .set { ch_main }
+
+ QC(ch_main.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [assembly_map_bam: null] ]},
+ pilon_polished.map {meta, polished -> [meta.id, polished ]},
+ meryl_kmers)
- versions = ch_versions
+ ch_main
+ .filter {
+ it -> it.meta.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.polished.pilon,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in, [])
emit:
- pilon_polished
+ ch_main
quast_out = QC.out.quast_out
busco_out = QC.out.busco_out
merqury_report_files = QC.out.merqury_report_files
- versions
}
diff --git a/subworkflows/local/polishing/pilon/run_pilon/main.nf b/subworkflows/local/polishing/pilon/run_pilon/main.nf
deleted file mode 100644
index e2c29efb..00000000
--- a/subworkflows/local/polishing/pilon/run_pilon/main.nf
+++ /dev/null
@@ -1,23 +0,0 @@
-include { PILON } from '../../../../../modules/nf-core/pilon/main'
-
-workflow RUN_PILON {
- take:
- assembly_in
- aln_to_assembly_bam_bai
-
- main:
- assembly_in
- .join(aln_to_assembly_bam_bai)
- .set { pilon_in }
- PILON(
- pilon_in.map { meta, assembly, _bam, _bai -> [meta, assembly] },
- pilon_in.map { meta, _assembly, bam, bai -> [meta, bam, bai] },
- "bam",
- )
- versions = PILON.out.versions
- improved_assembly = PILON.out.improved_assembly
-
- emit:
- improved_assembly
- versions
-}
diff --git a/subworkflows/local/prepare/jellyfish/main.nf b/subworkflows/local/prepare/jellyfish/main.nf
new file mode 100644
index 00000000..644ff638
--- /dev/null
+++ b/subworkflows/local/prepare/jellyfish/main.nf
@@ -0,0 +1,96 @@
+include { COUNT } from '../../../../modules/local/jellyfish/count/main'
+include { HISTO } from '../../../../modules/local/jellyfish/histo/main'
+include { STATS } from '../../../../modules/local/jellyfish/stats/main'
+include { GENOMESCOPE } from '../../../../modules/local/genomescope/main'
+
+workflow JELLYFISH {
+ take:
+ ch_main
+
+ main:
+ channel.empty().set { genomescope_in }
+ channel.empty().set { ch_versions }
+
+ ch_main
+ .filter { it -> it.meta.group }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.group,
+ it.meta.jellyfish_k,
+ it.meta.qc_reads_path,
+ it.meta.qc_read_mean
+ ]
+ }
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ meta: [
+ id: it[1],
+ metas: it[0],
+ jellyfish_k: it[2][0],
+ qc_read_mean: it[4][0]
+ ],
+ qc_reads_path: it[3][0]
+ ]
+ }
+ .mix(
+ ch_main
+ .filter { it -> !it.meta.group }
+ .map {
+ it ->
+ [
+ meta: it.meta,
+ qc_reads_path: it.meta.qc_reads_path
+ ]
+ }
+ )
+ .set { samples }
+
+ COUNT(samples)
+ COUNT.out.kmers.set { kmers }
+
+ HISTO(kmers)
+
+ HISTO.out.histo
+ .map { meta, hist ->
+ [
+ meta,
+ hist,
+ meta.jellyfish_k,
+ meta.qc_read_mean
+
+ ]
+ }
+ .set { genomescope_in }
+
+ STATS(kmers)
+
+ GENOMESCOPE(genomescope_in)
+
+ GENOMESCOPE.out.estimated_hap_len
+ .filter { it -> it[0].metas }
+ .flatMap { it ->
+ it[0].metas
+ .collect { meta -> [ meta: meta + [ genome_size: it[1] ] ] }
+ }
+ .mix(GENOMESCOPE.out.estimated_hap_len
+ .filter { it -> !it[0].metas }
+ .map {
+ it -> [ meta: it[0] + [ genome_size: it[1] ] ]
+ }
+ )
+ .set { outputs }
+
+ outputs.dump(tag: "Jellyfish outputs")
+
+ GENOMESCOPE.out.summary.set { genomescope_summary }
+
+ GENOMESCOPE.out.plot.set { genomescope_plot }
+
+ emit:
+ main_out = outputs
+ genomescope_summary
+ genomescope_plot
+}
diff --git a/subworkflows/local/prepare/main.nf b/subworkflows/local/prepare/main.nf
new file mode 100644
index 00000000..8e199465
--- /dev/null
+++ b/subworkflows/local/prepare/main.nf
@@ -0,0 +1,256 @@
+include { PREPARE_ONT as ONT } from './prepare_ont/main'
+include { PREPARE_HIFI as HIFI } from './prepare_hifi/main'
+include { PREPARE_SHORTREADS as SHORTREADS } from './prepare_shortreads/main'
+include { JELLYFISH } from './jellyfish/main'
+
+workflow PREPARE {
+ /*
+ Subworkflows in prepare implement sample grouping.
+ SHORTREADS, JELLYFISH, ONT and HIFI each implement
+ the same logic for sample grouping.
+ Grouping needs to be specified by the user, and can
+ be used to create sample groups that share inputs, to
+ minimize redundant input preparations.
+ Reads of samples from the same group will be prepared
+ only once, and then the original channel is restored.
+
+ Brief description how this works:
+ // Move group information into channel, if it exists
+ .filter { it -> it.meta.group }
+ .map { it -> [it.meta, it.meta.group, it.meta.ontreads] }
+ // Group by group
+ .groupTuple(by: 1)
+ // Collect all sample-meta into a group meta slot named metas
+ // Use unique reads; user responsible to group correctly
+ .map {
+ it ->
+ [
+ [
+ id: it[1], // the group
+ metas: it[0]
+ ],
+ it[2].unique()[0] // Ontreads
+ ]
+ }
+
+ After this input channel has been processed, the samples are
+ recreated from meta[metas]:
+
+ process.OUT
+ // Take samples with metas in slot [0]
+ .filter { it -> it[0].metas }
+ .flatMap { it ->
+ // $it looks like [meta, output_path]
+ // recreate meta from metas and update path.
+ it[0].metas
+ .collect { meta -> [
+ meta: meta - meta.subMap("ontreads") + [ontreads: it[1]]
+ ]
+ }
+ }
+ .mix(
+ process.OUT
+ .filter { it -> !it[0].metas }
+ .map {meta, ontreads -> [meta: meta -meta.subMap("ontreads") + [ontreads: ontreads]]}
+ )
+
+
+ */
+ take: ch_main
+
+ main:
+ channel.empty().set{ ch_main_shortreaded }
+ ch_main
+ .filter {
+ it -> ((it.meta.shortread_F && it.meta.use_short_reads) || it.hic_trim) ? true : false
+ }
+ .set { shortreads }
+
+ ch_main
+ .filter {
+ it -> (it.meta.ontreads) ? true : false
+ }
+ .set { ontreads }
+
+ ch_main
+ .filter {
+ it -> (it.meta.hifireads) ? true : false
+ }
+ .set { hifireads }
+
+
+ // adapted to sample-logic
+
+ SHORTREADS(shortreads)
+
+ SHORTREADS.out.meryl_kmers.set { meryl_kmers }
+
+ // This changes ch_main shortreads_F and _R become one tuple, paired is gone.
+
+ // put shortreads back together with samples without shortreads
+
+ // Added mix with empty to make sure that the channel exists
+ ch_main_shortreaded
+ .mix(
+ ch_main
+ .filter {
+ it -> !it.meta.shortread_F && !it.meta.hic_F
+ }
+ .map { it -> [meta: it.meta - it.meta.subMap("shortread_F","shortread_R", "paired") + [shorteads: null] ]}
+ .mix(SHORTREADS.out.main_out)
+ )
+ .set { ch_main_shortreaded }
+
+ ONT(ontreads)
+
+ ONT.out.main_out.set { ch_main_ont_prepped }
+
+ // Continue here with switching to meta
+
+ HIFI(hifireads)
+
+ HIFI.out.main_out.set { ch_main_hifi_prepped }
+
+ ch_main_shortreaded
+ // ADD ONT READS
+ .filter {
+ it -> it.meta.ontreads ? true : false
+ }
+ .map { it -> [it.meta.id, it.meta - it.meta.subMap("ontreads")]}
+ .join(
+ ch_main_ont_prepped
+ .map { it -> [it.meta.id, it.meta.ontreads] }
+ )
+ // After joining re-create the maps from the stored map
+ .map { _id, meta_old, ont_reads ->
+ [
+ meta: meta_old -meta_old.subMap("ontreads") + [ontreads: ont_reads]
+ ]
+ }
+ // mix back in those samples where nothing was done to the ont reads
+ .mix(ch_main_shortreaded
+ .filter {
+ it -> it.meta.ontreads ? false : true
+ }
+ )
+ .set {
+ ch_main_sr_ont
+ }
+
+ // Add prepared hifi-reads:
+
+ ch_main_sr_ont
+ .filter {
+ it -> it.meta.hifireads ? true : false
+ }
+ .map { it -> [it.meta.id, it.meta - it.meta.subMap("hifireads")]}
+ .join(
+ ch_main_hifi_prepped
+ .map { it -> [it.meta.id, it.meta.hifireads] }
+ )
+ // After joining re-create the maps from the stored map
+ .map { _id, meta_old, hifi_reads ->
+ [
+ meta: meta_old + [hifireads: hifi_reads]
+ ]
+ }
+ // mix back in those samples where nothing was done to the hifireads reads
+ .mix(ch_main_sr_ont
+ .filter {
+ it -> it.meta.hifireads ? false : true
+ }
+ )
+ .set {
+ ch_main_prepared
+ }
+
+ // Get average read length of the QC reads from fastplong json report
+ def slurp = new groovy.json.JsonSlurper()
+
+ ch_main_prepared
+ .filter { it -> it.meta.qc_reads.toLowerCase() == "ont" }
+ .map { it ->
+ [
+ it.meta.id,
+ it.meta - it.meta.subMap("fastplong_json")
+ ]
+ }
+ .join(
+ ONT.out.fastplong_ont_reports
+ .map { it -> [ it[0].id, it[1] ]}
+ )
+ .map {
+ _id, meta_old, json -> [meta: meta_old + [fastplong_json: json]]
+ }
+ .mix(
+ ch_main_prepared
+ .filter { it -> it.meta.qc_reads.toLowerCase() == "hifi" }
+ .map {
+ it -> [
+ it.meta.id, it.meta - it.meta.subMap("fastplong_json")]}
+ .join(
+ HIFI.out.fastplong_hifi_reports
+ .map { it -> [ it[0].id, it[1] ]}
+ )
+ .map {
+ _id, meta_old, json -> [meta: meta_old + [fastplong_json: json]]
+ }
+ )
+ .map { it ->
+ [
+ meta: it.meta +
+ [
+ qc_read_mean: slurp.parse(it.meta.fastplong_json)
+ .summary
+ .after_filtering
+ .read_mean_length ?:
+ slurp.parse(it.meta.fastplong_json)
+ .summary
+ .before_filtering
+ .read_mean_length
+ ]
+ ]
+ }
+ // branch this channel for jellyfish
+ .branch {
+ it ->
+ jelly: it.meta.jellyfish
+ no_jelly: !it.meta.jellyfish
+ }
+ .set { ch_main_jellyfish_branched }
+
+ JELLYFISH(ch_main_jellyfish_branched.jelly)
+
+
+ ch_main_jellyfish_branched.no_jelly
+ .mix( JELLYFISH.out.main_out )
+ // At this stage, make sure that qc_read_path for downstream qc is using the prepared reads.
+ .map { it ->
+ [
+ meta: it.meta -
+ it.meta.subMap("qc_read_path") +
+ [
+ qc_read_path: it.meta.qc_reads.toLowerCase() == "ont" ?
+ it.meta.ontreads :
+ it.meta.hifireads
+ ]
+ ]
+ }
+ .set { main_out }
+
+ main_out.dump(tag: "Prepare: Combined outputs")
+
+ JELLYFISH.out.genomescope_summary.set { genomescope_summary }
+
+ JELLYFISH.out.genomescope_plot.set { genomescope_plot }
+
+ fastplong_json_reports = HIFI.out.fastplong_hifi_reports.mix(ONT.out.fastplong_ont_reports)
+
+ emit:
+ ch_main = main_out
+ fastplong_json_reports
+ fastp_json_reports = SHORTREADS.out.fastp_json
+ meryl_kmers
+ genomescope_summary
+ genomescope_plot
+}
diff --git a/subworkflows/local/prepare/prepare_hifi/main.nf b/subworkflows/local/prepare/prepare_hifi/main.nf
new file mode 100644
index 00000000..798249ba
--- /dev/null
+++ b/subworkflows/local/prepare/prepare_hifi/main.nf
@@ -0,0 +1,86 @@
+include { FASTPLONG as FASTPLONG_HIFI } from '../../../../modules/nf-core/fastplong/main'
+
+workflow PREPARE_HIFI {
+ take:
+ main_in // should contain only samples with hifireads
+
+ main:
+ channel.empty().set { ch_versions }
+
+ main_in.dump(tag: "Prepare-HIFI input")
+
+ main_in
+ .filter { it -> it.meta.group }
+ .map { it -> [it.meta, it.meta.group, it.meta.hifi_trim, it.meta.hifireads, it.meta.hifi_adapters, it.meta.hifi_fastplong_args] }
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ meta: [
+ id: it[1],
+ metas: it[0],
+ trim: it[2][0], // These go in via config
+ hifi_fastplong_args: it[5][0]
+ ],
+ hifireads: it[3][0],
+ hifi_adapters: it[4][0]
+ ]
+ }
+ .mix(
+ main_in
+ .filter { it -> !it.meta.group }
+ .map {
+ it ->
+ [
+ meta: it.meta,
+ hifireads: it.meta.hifireads,
+ hifi_adapters: it.meta.hifi_adapters,
+ ]
+ }
+ )
+ .multiMap {
+ it ->
+ reads: [it.meta, it.hifireads]
+ adapters: it.hifi_adapters ?: []
+ }
+ .set { ch_fastplong_in }
+
+ ch_fastplong_in.reads.dump(tag: "HiFI fastplong reads in")
+
+ FASTPLONG_HIFI(ch_fastplong_in.reads, ch_fastplong_in.adapters, false, false )
+
+ FASTPLONG_HIFI
+ .out
+ .reads
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // it looks like [meta, output_path]
+ it[0].metas
+ .collect { metas -> [ meta: metas - metas.subMap("hifireads") + [hifireads: it[1]] ] }
+ }
+ .mix(FASTPLONG_HIFI.out.reads
+ .filter { it -> !it[0].metas }
+ .map {
+ meta, hifireads -> [ meta: meta - meta.subMap("hifireads") + [ hifireads: hifireads ] ]
+ }
+ )
+ .set { fastplong_reads_out }
+
+ FASTPLONG_HIFI
+ .out
+ .json
+ .filter { it -> it[0].metas }
+ .flatMap { it ->
+ it[0].metas
+ .collect { meta -> [ meta, it[1] ] }
+ }
+ .mix(FASTPLONG_HIFI.out.json
+ .filter { it -> !it[0].metas }
+ )
+ .set { fastplong_json_out }
+
+ fastplong_reads_out.dump(tag: "Prepare-HIFI output")
+
+ emit:
+ main_out = fastplong_reads_out
+ fastplong_hifi_reports = fastplong_json_out
+}
diff --git a/subworkflows/local/prepare/prepare_ont/collect/main.nf b/subworkflows/local/prepare/prepare_ont/collect/main.nf
new file mode 100644
index 00000000..c4fcff03
--- /dev/null
+++ b/subworkflows/local/prepare/prepare_ont/collect/main.nf
@@ -0,0 +1,20 @@
+include { COLLECT_READS } from '../../../../../modules/local/collect_reads/main'
+
+workflow COLLECT {
+ take:
+ ch_input
+
+ main:
+ ch_input
+ .filter {
+ it -> it.ont_collect
+ }
+ .map { row -> [row.meta, row.meta.ontreads] }
+ .set { reads }
+
+ COLLECT_READS(reads)
+ COLLECT_READS.out.combined_reads.set { reads }
+
+ emit:
+ reads
+}
diff --git a/subworkflows/local/prepare/prepare_ont/main.nf b/subworkflows/local/prepare/prepare_ont/main.nf
new file mode 100644
index 00000000..ac9c6c7b
--- /dev/null
+++ b/subworkflows/local/prepare/prepare_ont/main.nf
@@ -0,0 +1,145 @@
+include { FASTPLONG as FASTPLONG_ONT } from '../../../../modules/nf-core/fastplong/main'
+include { COLLECT } from './collect/main'
+
+
+workflow PREPARE_ONT {
+ take:
+ ch_main // should contain only samples with ontreads
+
+ main:
+ channel.empty().set { ch_versions }
+
+ ch_main.dump(tag: "Prepare-ONT input")
+ ch_main
+ .branch {
+ it ->
+ to_collect: it.meta.ont_collect
+ no_collect: !it.meta.ont_collect
+ }
+ .set { ch_main_collect_branched }
+
+ ch_main_collect_branched
+ .to_collect
+ .filter { it -> it.meta.group }
+ .map { it -> [it.meta, it.meta.group, it.meta.ontreads] }
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ [
+ id: it[1], // the group
+ metas: it[0]
+ ],
+ it[2].unique()[0] // Ontreads
+ ]
+ }
+ .mix(
+ ch_main_collect_branched
+ .to_collect
+ .filter { it -> !it.meta.group }
+ .map {
+ it -> [ it.meta, it.meta.ontreads ]
+ }
+ )
+ .set { collect_in }
+
+ COLLECT(collect_in)
+
+ COLLECT.out.reads
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // it looks like [meta, output_path]
+ it[0].metas
+ .collect { meta -> [ meta: meta - meta.subMap("ontreads") + [ontreads: it[1]] ] }
+ }
+ .mix(
+ COLLECT.out.reads
+ .filter { it -> !it[0].metas }
+ .map {
+ meta, ontreads -> [ meta: meta - meta.subMap("ontreads") + [ontreads: ontreads] ]
+ }
+ )
+ .set { ch_collected_reads }
+
+ ch_collected_reads.dump(tag: "Collected ONT reads")
+
+ ch_collected_reads
+ .mix(ch_main_collect_branched.no_collect)
+ .set { ch_collected }
+
+ ch_collected.dump(tag: "Collected reads mixed with uncollected.")
+
+ // ch_collected is the same samples as the input channel
+ ch_collected
+ .filter { it -> it.meta.group }
+ .map { it -> [it.meta, it.meta.group, it.meta.ont_trim, it.meta.ontreads, it.meta.ont_adaptors, it.meta.ont_fastplong_args] }
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ meta: [
+ id: it[1],
+ metas: it[0],
+ trim: it[2][0],
+ ont_fastplong_args: it[5][0]
+ ],
+ ontreads: it[3][0],
+ ont_adaptors: it[4][0]
+ ]
+ }
+ .mix(
+ ch_collected
+ .filter { it -> !it.meta.group }
+ .map {
+ it ->
+ [
+ meta: it.meta,
+ ontreads: it.meta.ontreads,
+ ont_adaptors: it.meta.ont_adaptors,
+ ]
+ }
+ )
+ .multiMap {
+ it ->
+ reads: [it.meta, it.ontreads]
+ adapters: it.ont_adapters ?: []
+ }
+ .set { ch_fastplong_in }
+
+ FASTPLONG_ONT(ch_fastplong_in.reads, ch_fastplong_in.adapters, false, false)
+
+ FASTPLONG_ONT
+ .out
+ .reads
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // it looks like [meta, output_path]
+ it[0].metas
+ .collect { metas -> [ meta: metas - metas.subMap("ontreads") + [ ontreads: it[1] ] ] }
+ }
+ .mix(FASTPLONG_ONT.out.reads
+ .filter { it -> !it[0].metas }
+ .map {
+ it -> [ meta: it[0] - it[0].subMap("ontreads") + [ ontreads: it[1] ] ]
+ }
+ )
+ .set { fastplong_reads_out }
+
+ FASTPLONG_ONT
+ .out
+ .json
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // it looks like [meta, output_path]
+ it[0].metas
+ .collect { metas -> [metas, it[1] ] }
+ }
+ .mix(
+ FASTPLONG_ONT.out.json
+ .filter { it -> !it[0].metas }
+ )
+ .set { fastplong_json_out }
+
+ fastplong_reads_out.dump(tag: "Prepare-ONT output")
+
+ emit:
+ main_out = fastplong_reads_out
+ fastplong_ont_reports = fastplong_json_out
+}
diff --git a/subworkflows/local/prepare/prepare_shortreads/main.nf b/subworkflows/local/prepare/prepare_shortreads/main.nf
new file mode 100644
index 00000000..87301de2
--- /dev/null
+++ b/subworkflows/local/prepare/prepare_shortreads/main.nf
@@ -0,0 +1,249 @@
+include { FASTP } from '../../../../modules/nf-core/fastp/main'
+include { FASTP as FASTP_HIC } from '../../../../modules/nf-core/fastp/main'
+include { MERYL_COUNT } from '../../../../modules/nf-core/meryl/count/main'
+include { MERYL_UNIONSUM } from '../../../../modules/nf-core/meryl/unionsum/main'
+
+workflow PREPARE_SHORTREADS {
+ take:
+ shortreads_in
+
+ main:
+ channel.empty().set { ch_versions }
+
+ shortreads_in
+ .map { row -> row.meta.shortread_F ? create_shortread_channel(row.meta) : row } // function below
+ .branch {
+ it ->
+ trim: it.meta.shortread_trim
+ no_trim: !it.meta.shortread_trim
+ }
+ .set { shortreads }
+
+ shortreads_in
+ .map { row -> row.meta.hic_F ? create_hic_shortread_channel(row.meta) : row }
+ .branch {
+ row ->
+ trim: row.meta.hic_trim
+ no_trim: !row.meta.hic_trim
+ }
+ .set { hic_trim }
+
+ shortreads.trim.dump(tag: "shortread trim channel")
+ hic_trim.trim.dump(tag: "hic trim channel")
+
+ shortreads
+ .trim
+ .filter { it -> it.meta.group }
+ .map { it -> [it.meta, it.meta.group] }
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ [
+ id: it[1], // the group
+ metas: it[0]
+ ],
+ it[0].shortreads[0], // Pull path from meta
+ []
+ ]
+ }
+ .mix(
+ shortreads
+ .trim
+ .filter { it -> !it.meta.group }
+ .map {
+ it -> [ it.meta, it.meta.shortreads, [] ]
+ }
+ )
+ .set { trim_in }
+
+ hic_trim
+ .trim
+ .filter { it -> it.meta.group }
+ .map {it -> [it.meta, it.meta.group]}
+ .groupTuple(by: 1)
+ .map {
+ it ->
+ [
+ [
+ id: it[1], // the group
+ metas: it[0]
+ ],
+ it[0].hic_reads[0], // Pull path from meta
+ []
+ ]
+ }
+ .mix(
+ hic_trim
+ .trim
+ .filter { it -> !it.meta.group }
+ .map {
+ it -> [ it.meta, it.meta.hic_reads, [] ]
+ }
+ )
+ .set { hic_trim_in }
+
+ trim_in.dump(tag: "Trim in")
+
+ FASTP(trim_in, false, false, false)
+
+ FASTP.out.reads
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // looks like [meta <[id, metas]>, output_path]
+ it[0].metas
+ .collect { meta -> [ meta: meta - meta.subMap("shortreads") + [ shortreads: it[1] ] ] }
+ }
+ .mix(
+ FASTP.out.reads
+ .filter { it -> !it[0].metas }
+ .map { it -> [ meta: it[0] - it[0].subMap("shortreads") + [ shortreads: it[1] ] ] }
+ )
+ .set { trimmed_reads }
+
+ trimmed_reads.dump(tag: "Trim out")
+ // unite branched:
+ // add trimmed reads to trim channel, then mix with shortreads.no_trim
+
+ FASTP_HIC(hic_trim_in, false, false, false)
+
+ FASTP_HIC.out.reads
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // looks like [meta <[id, metas]>, output_path]
+ it[0].metas
+ .collect { meta -> [ meta: meta - meta.subMap("hic_reads") + [ hic_reads: it[1] ] ] }
+ }
+ .mix(
+ FASTP_HIC.out.reads
+ .filter { it -> !it[0].metas }
+ .map { it -> [ meta: it[0] - it[0].subMap("hic_reads") + [ hic_reads: it[1] ] ] }
+ )
+ .set { hic_trimmed_reads }
+
+ trimmed_reads
+ .mix( shortreads.no_trim )
+ .set { shortreads }
+
+ // add HiC trimmed to those that need it
+
+ shortreads
+ .filter { row -> row.meta.hic_trim }
+ .map { row -> [ row.meta.id, row.meta ] }
+ .combine(
+ hic_trimmed_reads
+ .map { it ->
+ [
+ it.meta.id,
+ it.meta.hic_reads
+ ]
+ },
+ by: 0
+ )
+ .map {
+ _id, meta, trimmed_hic_reads ->
+ [
+ meta: meta - meta.subMap("hic_reads") + [ hic_reads: trimmed_hic_reads ]
+ ]
+ }
+ .mix(
+ trimmed_reads
+ .filter { row -> !row.meta.hic_trim }
+ .map { it-> [meta: it.meta - it.meta.subMap("hic_reads") + [hic_reads: null]]}
+ )
+ .set { shortreads }
+
+ shortreads
+ .filter { it -> it.meta.merqury }
+ .filter { it -> it.meta.group }
+ .map { it -> [ it.meta, it.meta.group, it.meta.shortreads, it.meta.meryl_k ] }
+ // Create a group
+ .groupTuple(by: 1)
+ .map {
+ it -> [
+ meta: [ id: it[1], metas: it[0] ],
+ shortreads: it[2][0],
+ meryl_k: it[3][0]
+ ]
+ }
+ .mix(shortreads
+ .filter { it -> it.meta.merqury }
+ .filter { it -> !it.meta.group }
+ .map { it -> [meta: it.meta, shortreads: it.meta.shortreads, meryl_k: it.meta.meryl_k]}
+ )
+ .multiMap { it ->
+ reads: [ it.meta, it.shortreads ]
+ kmer_size: it.meryl_k
+ }
+ .set { meryl_in }
+
+ MERYL_COUNT(meryl_in.reads, meryl_in.kmer_size)
+
+ MERYL_UNIONSUM(MERYL_COUNT.out.meryl_db, params.meryl_k)
+
+ MERYL_UNIONSUM.out.meryl_db
+ .filter { it -> it[0].metas }
+ .flatMap { it -> // looks like [meta <[id, metas]>, output_path]
+ it[0].metas
+ .collect { meta -> [ meta, it[1] ] }
+ }
+ .mix(MERYL_UNIONSUM.out.meryl_db
+ .filter { it -> !it[0].metas }
+ .map {
+ it -> [ it[0], it[1] ]
+ }
+ )
+ .map {meta , kmers -> [meta.id, kmers]}
+ .set { meryl_kmers }
+
+
+
+ emit:
+ main_out = shortreads
+ fastp_json = FASTP.out.json
+ meryl_kmers
+}
+
+def create_shortread_channel(row) { // This function expects a meta map as input
+ // create meta map
+ def meta = row
+ meta.paired = row.paired.toBoolean()
+ meta.single_end = !meta.paired
+
+ // add path(s) of the fastq file(s) to the meta map
+ def shortreads = []
+ if (!file(row.shortread_F).exists()) {
+ exit(1, "ERROR: shortread_F fastq file does not exist!\n${row.shortread_F}")
+ }
+ if (!meta.paired) {
+ shortreads = [meta: meta + [shortreads: [file(row.shortread_F)]]]
+ }
+ else {
+ if (!file(row.shortread_R).exists()) {
+ exit(1, "ERROR: shortread_R fastq file does not exist!\n${row.shortread_R}")
+ }
+ shortreads = [ meta: meta + [shortreads: [file(row.shortread_F), file(row.shortread_R)]] ]
+ }
+ return shortreads
+}
+
+def create_hic_shortread_channel(row) { // This function expects a meta map as input
+ // create meta map
+ def meta = row
+ meta.paired = true
+ meta.single_end = !meta.paired
+
+ // add path(s) of the fastq file(s) to the meta map
+ def hic_reads = []
+ if (!file(row.hic_F).exists()) {
+ exit(1, "ERROR: hic_F fastq file does not exist!\n${row.hic_F}")
+ }
+ if (!meta.paired) {
+ hic_reads = [meta: meta + [hic_reads: [file(row.hic_F)]]]
+ }
+ else {
+ if (!file(row.hic_R).exists()) {
+ exit(1, "ERROR: shortread_R fastq file does not exist!\n${row.hic_R}")
+ }
+ hic_reads = [ meta: meta + [hic_reads: [file(row.hic_F), file(row.hic_R)]] ]
+ }
+ return hic_reads
+}
diff --git a/subworkflows/local/prepare_hifi/main.nf b/subworkflows/local/prepare_hifi/main.nf
deleted file mode 100644
index 3eda0a32..00000000
--- a/subworkflows/local/prepare_hifi/main.nf
+++ /dev/null
@@ -1,27 +0,0 @@
-include { LIMA } from '../../../modules/nf-core/lima/main'
-include { SAMTOOLS_FASTQ as TO_FASTQ } from '../../../modules/nf-core/samtools/fastq/main'
-
-workflow PREPARE_HIFI {
- take:
- inputs
-
- main:
- Channel.empty().set { ch_versions }
- inputs
- .map { it -> [it.meta, it.hifireads] }
- .set { hifireads }
- if (params.lima) {
- if (!params.pacbio_primers) {
- error('Trimming with lima requires a file containing primers (--pacbio_primers)')
- }
- LIMA(hifireads, params.pacbio_primers)
- TO_FASTQ(LIMA.out.bam, false)
- TO_FASTQ.out.set { hifireads }
- ch_versions.mix(LIMA.out.versions).mix(TO_FASTQ.out.versions)
- }
- versions = ch_versions
-
- emit:
- hifireads
- versions
-}
diff --git a/subworkflows/local/prepare_ont/chop/main.nf b/subworkflows/local/prepare_ont/chop/main.nf
deleted file mode 100644
index 0fa31419..00000000
--- a/subworkflows/local/prepare_ont/chop/main.nf
+++ /dev/null
@@ -1,24 +0,0 @@
-include { PORECHOP_PORECHOP as PORECHOP } from '../../../../modules/nf-core/porechop/porechop/main'
-
-workflow CHOP {
- take:
- in_reads
-
- main:
- Channel.empty().set { chopped_reads }
- Channel.empty().set { ch_versions }
-
- if (params.porechop) {
- PORECHOP(in_reads)
- PORECHOP.out.reads.set { chopped_reads }
- ch_versions.mix(PORECHOP.out.versions)
- }
- else {
- in_reads.set { chopped_reads }
- }
- versions = ch_versions
-
- emit:
- chopped_reads
- versions
-}
diff --git a/subworkflows/local/prepare_ont/collect/main.nf b/subworkflows/local/prepare_ont/collect/main.nf
deleted file mode 100644
index aea3fdec..00000000
--- a/subworkflows/local/prepare_ont/collect/main.nf
+++ /dev/null
@@ -1,24 +0,0 @@
-include { COLLECT_READS } from '../../../../modules/local/collect_reads/main'
-
-workflow COLLECT {
- take:
- ch_input
-
- main:
- Channel.empty().set { ch_versions }
-
- ch_input
- .map { row -> [row.meta, row.ontreads] }
- .set { reads }
-
- if (params.collect) {
- COLLECT_READS(reads)
- COLLECT_READS.out.combined_reads.set { reads }
- ch_versions.mix(COLLECT_READS.out.versions)
- }
- versions = ch_versions
-
- emit:
- reads
- versions
-}
diff --git a/subworkflows/local/prepare_ont/main.nf b/subworkflows/local/prepare_ont/main.nf
deleted file mode 100644
index 52c8522e..00000000
--- a/subworkflows/local/prepare_ont/main.nf
+++ /dev/null
@@ -1,34 +0,0 @@
-include { CHOP } from './chop/main'
-include { COLLECT } from './collect/main'
-include { RUN_NANOQ } from './run_nanoq/main'
-
-workflow PREPARE_ONT {
- take:
- inputs
-
- main:
- Channel.empty().set { ch_versions }
-
- COLLECT(inputs)
-
- CHOP(COLLECT.out.reads)
-
- CHOP.out.chopped_reads.set { trimmed }
-
- RUN_NANOQ(trimmed)
-
- RUN_NANOQ.out.median_length.set { med_len }
-
- RUN_NANOQ.out.report.set { nanoq_report }
-
- RUN_NANOQ.out.stats.set { nanoq_stats }
-
- versions = ch_versions.mix(COLLECT.out.versions).mix(CHOP.out.versions).mix(RUN_NANOQ.out.versions)
-
- emit:
- trimmed
- med_len
- nanoq_report
- nanoq_stats
- versions
-}
diff --git a/subworkflows/local/prepare_ont/run_nanoq/main.nf b/subworkflows/local/prepare_ont/run_nanoq/main.nf
deleted file mode 100644
index 4f78c859..00000000
--- a/subworkflows/local/prepare_ont/run_nanoq/main.nf
+++ /dev/null
@@ -1,25 +0,0 @@
-include { NANOQ } from '../../../../modules/local/nanoq/main'
-
-workflow RUN_NANOQ {
- take:
- in_reads
-
- main:
- Channel.empty().set { versions }
-
- NANOQ(in_reads)
-
- NANOQ.out.report.set { report }
-
- NANOQ.out.stats.set { stats }
-
- NANOQ.out.median_length.set { median_length }
-
- NANOQ.out.versions.set { versions }
-
- emit:
- report
- stats
- median_length
- versions
-}
diff --git a/subworkflows/local/prepare_shortreads/main.nf b/subworkflows/local/prepare_shortreads/main.nf
deleted file mode 100644
index 78641add..00000000
--- a/subworkflows/local/prepare_shortreads/main.nf
+++ /dev/null
@@ -1,55 +0,0 @@
-include { TRIMGALORE } from '../../../modules/nf-core/trimgalore/main'
-include { MERYL_COUNT } from '../../../modules/nf-core/meryl/count/main'
-include { MERYL_UNIONSUM } from '../../../modules/nf-core/meryl/unionsum/main'
-
-workflow PREPARE_SHORTREADS {
- take:
- input_channel
-
- main:
- Channel.empty().set { ch_versions }
-
- input_channel
- .map { create_shortread_channel(it) }
- .set { shortreads }
-
- if (params.trim_short_reads) {
- TRIMGALORE(shortreads)
- TRIMGALORE.out.reads.set { shortreads }
- ch_versions = ch_versions.mix(TRIMGALORE.out.versions)
- }
- MERYL_COUNT(shortreads.map { it -> [it[0], it[1]] }, params.meryl_k)
- MERYL_UNIONSUM(MERYL_COUNT.out.meryl_db, params.meryl_k)
- MERYL_UNIONSUM.out.meryl_db.set { meryl_kmers }
-
- versions = ch_versions.mix(MERYL_COUNT.out.versions).mix(MERYL_UNIONSUM.out.versions)
-
- emit:
- shortreads
- meryl_kmers
- versions
-}
-
-def create_shortread_channel(row) {
- // create meta map
- def meta = [:]
- meta.id = row.meta.id
- meta.paired = row.paired.toBoolean()
- meta.single_end = !meta.paired
-
- // add path(s) of the fastq file(s) to the meta map
- def shortreads = []
- if (!file(row.shortread_F).exists()) {
- exit(1, "ERROR: shortread_F fastq file does not exist!\n${row.shortread_F}")
- }
- if (!meta.paired) {
- shortreads = [meta, [file(row.shortread_F)]]
- }
- else {
- if (!file(row.shortread_R).exists()) {
- exit(1, "ERROR: shortread_R fastq file does not exist!\n${row.shortread_R}")
- }
- shortreads = [meta, [file(row.shortread_F), file(row.shortread_R)]]
- }
- return shortreads
-}
diff --git a/subworkflows/local/qc/busco/main.nf b/subworkflows/local/qc/busco/main.nf
deleted file mode 100644
index 93d93c5e..00000000
--- a/subworkflows/local/qc/busco/main.nf
+++ /dev/null
@@ -1,26 +0,0 @@
-include { BUSCO_BUSCO as BUSCO } from '../../../../modules/nf-core/busco/busco/main'
-
-workflow RUN_BUSCO {
- take:
- assembly
-
- main:
- Channel.empty().set { versions }
- Channel.empty().set { batch_summary }
- Channel.empty().set { short_summary_txt }
- Channel.empty().set { short_summary_json }
-
- if (params.busco) {
- BUSCO(assembly, 'genome', params.busco_lineage, params.busco_db ? file(params.busco_db, checkIfExists: true) : [], [], true)
- BUSCO.out.batch_summary.set { batch_summary }
- BUSCO.out.short_summaries_txt.set { short_summary_txt }
- BUSCO.out.short_summaries_json.set { short_summary_json }
- BUSCO.out.versions.set { versions }
- }
-
- emit:
- batch_summary
- short_summary_json
- short_summary_txt
- versions
-}
diff --git a/subworkflows/local/qc/main.nf b/subworkflows/local/qc/main.nf
index bba6b31d..6f4cdf57 100644
--- a/subworkflows/local/qc/main.nf
+++ b/subworkflows/local/qc/main.nf
@@ -1,61 +1,132 @@
include { MAP_TO_ASSEMBLY } from '../mapping/map_to_assembly/main'
-include { RUN_BUSCO } from './busco/main.nf'
-include { RUN_QUAST } from './quast/main.nf'
-include { MERQURY_QC } from './merqury/main.nf'
+include { QUAST } from '../../../modules/local/quast/main'
+include { BUSCO_BUSCO as BUSCO } from '../../../modules/nf-core/busco/busco/main'
+include { MERQURY_MERQURY as MERQURY } from '../../../modules/nf-core/merqury/merqury/main'
workflow QC {
take:
- inputs
- in_reads
+ ch_main
scaffolds
- aln_to_ref
meryl_kmers
main:
- Channel.empty().set { ch_versions }
- Channel.empty().set { quast_out }
- Channel.empty().set { busco_out }
- Channel.empty().set { merqury_report_files }
- Channel.empty().set { map_to_assembly }
-
- if (params.quast) {
- MAP_TO_ASSEMBLY(in_reads, scaffolds)
- MAP_TO_ASSEMBLY.out.aln_to_assembly_bam.set { map_to_assembly }
- ch_versions = ch_versions.mix(MAP_TO_ASSEMBLY.out.versions)
- }
-
- RUN_QUAST(scaffolds, inputs, aln_to_ref, map_to_assembly)
- RUN_QUAST.out.quast_tsv.set { quast_out }
-
- ch_versions = ch_versions.mix(RUN_QUAST.out.versions)
-
- RUN_BUSCO(scaffolds)
- RUN_BUSCO.out.batch_summary.set { busco_out }
-
- ch_versions = ch_versions.mix(RUN_BUSCO.out.versions)
-
- if (params.short_reads) {
- MERQURY_QC(scaffolds, meryl_kmers)
- MERQURY_QC.out.stats
- .join(
- MERQURY_QC.out.spectra_asm_hist
- )
- .join(
- MERQURY_QC.out.spectra_cn_hist
- )
- .join(
- MERQURY_QC.out.assembly_qv
- )
- .set { merqury_report_files }
-
- ch_versions = ch_versions.mix(MERQURY_QC.out.versions)
- }
-
- versions = ch_versions
+ channel.empty().set { quast_out }
+ channel.empty().set { busco_out }
+ channel.empty().set { merqury_report_files }
+
+ ch_main
+ .branch {
+ it ->
+ shortread: it.meta.use_short_reads
+ no_shortread: !it.meta.use_short_reads
+ }
+ .set { ch_shortread_branched }
+
+ ch_shortread_branched
+ .shortread
+ .filter { it -> it.meta.merqury }
+ .map { it -> [it.meta.id, it.meta] }
+ .join(scaffolds)
+ .join(meryl_kmers)
+ .map { _id, meta, scaffs, kmers ->
+ [ meta, kmers, scaffs ]
+ }
+ .set { merqury_in }
+
+ MERQURY(merqury_in)
+
+ // Make sure that Polish and Scaffold main channels do not contain assembly_map_bam
+
+ ch_main
+ .branch {
+ it ->
+ map_to_assembly: it.meta.quast && !it.meta.assembly_map_bam
+ no_map_to_assembly: !it.meta.quast || (it.meta.quast && it.meta.assembly_map_bam)
+ }
+ .set { ch_map_branched }
+
+ ch_map_branched
+ .map_to_assembly
+ .map {
+ it -> [ it.meta.id, it.meta ]
+ }
+ .join(scaffolds)
+ .map {
+ _id, meta, target_scaffolds ->
+ [
+ meta + [qc_target: target_scaffolds], // QC Target only exists in QC channel, and takes the scaffold that should be qc'ed
+ meta.qc_reads_path,
+ target_scaffolds
+ ]
+ }
+ .set { map_assembly_in }
+
+ MAP_TO_ASSEMBLY(map_assembly_in)
+
+ // create main channel with mappings
+ MAP_TO_ASSEMBLY.out.aln_to_assembly_bam
+ .map { meta, assembly_map_bam ->
+ [
+ meta: meta + [ assembly_map_bam: assembly_map_bam ]
+ ]
+ }
+ .mix(ch_map_branched.no_map_to_assembly)
+ .set { ch_qc }
+
+ ch_qc
+ .filter {
+ it -> it.meta.quast
+ }
+ .multiMap { it ->
+ quast_in: [
+ it.meta,
+ it.meta.qc_target,
+ it.meta.ref_fasta ?: [],
+ it.meta.ref_gff ?: [],
+ it.meta.ref_map_bam ?: [],
+ it.meta.assembly_map_bam
+ ]
+ use_ref: it.meta.use_ref
+ use_gff: it.meta.use_ref && it.meta.ref_gff ? true : false
+ }
+ .set { quast_in }
+
+ QUAST(quast_in) // works magically
+ QUAST.out.tsv.set { quast_out }
+
+ ch_qc
+ .filter {
+ it -> it.meta.busco
+ }
+ .multiMap { it ->
+ fasta: [
+ it.meta,
+ it.meta.qc_target
+ ]
+ busco_lineage: it.meta.busco_lineage
+ busco_db: it.meta.busco_db ? file(it.meta.busco_db, checkIfExists: true) : []
+ }
+ .set { busco_in }
+
+ BUSCO(busco_in.fasta, 'genome', busco_in.busco_lineage, busco_in.busco_db , [], true)
+ BUSCO.out.batch_summary.set { busco_out }
+
+
+ MERQURY.out.stats
+ .join(
+ MERQURY.out.spectra_asm_hist
+ )
+ .join(
+ MERQURY.out.spectra_cn_hist
+ )
+ .join(
+ MERQURY.out.assembly_qv
+ )
+ .set { merqury_report_files }
emit:
+ ch_main // QC does not (and should not) modify ch_main but returns the input.
quast_out
busco_out
merqury_report_files
- versions
}
diff --git a/subworkflows/local/qc/merqury/main.nf b/subworkflows/local/qc/merqury/main.nf
deleted file mode 100644
index 8ee300d3..00000000
--- a/subworkflows/local/qc/merqury/main.nf
+++ /dev/null
@@ -1,33 +0,0 @@
-include { MERQURY_MERQURY as MERQURY } from '../../../../modules/nf-core/merqury/merqury/main'
-
-workflow MERQURY_QC {
- take:
- assembly
- meryl_out
-
- main:
- Channel.empty().set { versions }
- assembly.map { meta, _assembly -> [meta.id, []] }.set { stats }
- assembly.map { meta, _assembly -> [meta.id, []] }.set { spectra_asm_hist }
- assembly.map { meta, _assembly -> [meta.id, []] }.set { spectra_cn_hist }
- assembly.map { meta, _assembly -> [meta.id, []] }.set { assembly_qv }
- if (params.merqury) {
- meryl_out
- .map { it -> [[id: it[0].id], it[1]] }
- .join(assembly)
- .set { merqury_in }
- MERQURY(merqury_in)
- MERQURY.out.stats.set { stats }
- MERQURY.out.spectra_asm_hist.set { spectra_asm_hist }
- MERQURY.out.spectra_cn_hist.set { spectra_cn_hist }
- MERQURY.out.assembly_qv.set { assembly_qv }
- MERQURY.out.versions.set { versions }
- }
-
- emit:
- stats
- spectra_asm_hist
- spectra_cn_hist
- assembly_qv
- versions
-}
diff --git a/subworkflows/local/qc/quast/main.nf b/subworkflows/local/qc/quast/main.nf
deleted file mode 100644
index bf7a4566..00000000
--- a/subworkflows/local/qc/quast/main.nf
+++ /dev/null
@@ -1,42 +0,0 @@
-include { QUAST } from '../../../../modules/local/quast/main'
-
-workflow RUN_QUAST {
- take:
- assembly
- inputs
- aln_to_ref
- aln_to_assembly
-
- main:
- Channel.empty().set { versions }
- /* prepare for quast:
- * This makes use of the input channel to obtain the reference and reference annotations
- * See quast module for details
- */
- Channel.empty().set { quast_results }
- Channel.empty().set { quast_tsv }
-
- if (params.quast) {
- inputs
- .map { row -> [row.meta, row.ref_fasta, row.ref_gff] }
- .set { inputs_references }
-
- assembly
- .join(inputs_references)
- .join(aln_to_ref)
- .join(aln_to_assembly)
- .set { quast_in }
- /*
- * Run QUAST
- */
- QUAST(quast_in, params.use_ref, false)
- QUAST.out.results.set { quast_results }
- QUAST.out.tsv.set { quast_tsv }
- QUAST.out.versions.set { versions }
- }
-
- emit:
- quast_results
- quast_tsv
- versions
-}
diff --git a/subworkflows/local/scaffold/hic/main.nf b/subworkflows/local/scaffold/hic/main.nf
new file mode 100644
index 00000000..1d3da509
--- /dev/null
+++ b/subworkflows/local/scaffold/hic/main.nf
@@ -0,0 +1,142 @@
+include { QC } from '../../qc/main'
+include { YAHS } from '../../../../modules/nf-core/yahs/main'
+include { RUN_LIFTOFF } from '../../liftoff/main'
+include { BWAMEM2_MEM } from '../../../../modules/nf-core/bwamem2/mem/main'
+include { BWAMEM2_INDEX } from '../../../../modules/nf-core/bwamem2/index/main'
+include { SAMTOOLS_FAIDX } from '../../../../modules/nf-core/samtools/faidx/main'
+include { MINIMAP2_ALIGN as MINIMAP2_HIC } from '../../../../modules/nf-core/minimap2/align/main'
+include { PICARD_MARKDUPLICATES as MARKDUP } from '../../../../modules/nf-core/picard/markduplicates/main'
+include { PICARD_ADDORREPLACEREADGROUPS as ADD_RG } from '../../../../modules/nf-core/picard/addorreplacereadgroups/main'
+workflow HIC {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+ channel.empty().set { ch_versions }
+
+ ch_main
+ .branch { it ->
+ bwamem: it.meta.hic_aligner == "bwa-mem2"
+ minimap: it.meta.hic_aligner == "minimap2"
+ }
+ .set {
+ hic_align_branched
+ }
+
+ hic_align_branched
+ .bwamem
+ .map {
+ it ->
+ [
+ it.meta,
+ it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly
+ ]
+ }
+ .set { bwamem_index_in }
+
+ BWAMEM2_INDEX(bwamem_index_in)
+ BWAMEM2_INDEX.out.index
+ .map {meta, idx ->
+ [meta: meta + [bwamem_idx: idx]]
+ }
+ .multiMap {
+ it ->
+ reads: [it.meta, it.meta.hic_reads]
+ assembly: [it.meta, it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly]
+ index: [it.meta, it.meta.bwamem_idx]
+ }
+ .set{bwamem_mem_in}
+
+ BWAMEM2_MEM(bwamem_mem_in.reads, bwamem_mem_in.index, bwamem_mem_in.assembly, true)
+
+ hic_align_branched
+ .minimap
+ .map { it ->
+ [
+ it.meta,
+ it.meta.hic_reads,
+ it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly
+ ]
+ }
+ .set {minimap2_in}
+
+ MINIMAP2_HIC(minimap2_in, true, "csi", [], [])
+
+ BWAMEM2_MEM.out.bam.mix(MINIMAP2_HIC.out.bam).set{ add_rg_in }
+
+ ADD_RG(add_rg_in, [[],[]], [[],[]])
+
+ MARKDUP(ADD_RG.out.bam, [[],[]], [[],[]])
+
+ MARKDUP.out.bam
+ .map { meta, bam -> [meta.id, meta, bam] }
+ .join(
+ MARKDUP.out.bai
+ .map { meta, bai -> [meta.id, bai] }
+ )
+ .map {_id, meta, bam, bai -> [meta:meta + [hic_dedup_bam: bam, hic_dedup_bai: bai] ]}
+ .map {
+ it -> [
+ it.meta,
+ it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly,
+ []
+ ]
+ }
+ .set { faidx_in }
+
+ SAMTOOLS_FAIDX(faidx_in, false)
+
+ SAMTOOLS_FAIDX.out.fai
+ .map {
+ meta, index ->
+ [
+ meta: meta + [hic_genome_idx: index]
+ ]
+ }
+ .set { indexed }
+
+ indexed
+ .map { it ->
+ [
+ it.meta,
+ it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly,
+ it.meta.hic_genome_idx,
+ it.meta.hic_dedup_bam,
+ []
+ ]
+ }
+ .set { yahs_in }
+
+ YAHS(yahs_in)
+
+ YAHS.out.scaffolds_fasta
+ .map { meta, corrected -> [meta: meta + [ scaffolds_hic: corrected] ] }
+ .set { ch_main_scaffolded }
+
+ QC(ch_main_scaffolded.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [assembly_map_bam: null] ] },
+ YAHS.out.scaffolds_fasta.map { meta, corrected -> [ meta.id, corrected ] },
+ meryl_kmers)
+
+ ch_main_scaffolded
+ .filter {
+ it -> it.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.scaffolds_hic,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ RUN_LIFTOFF(liftoff_in)
+
+ emit:
+ ch_main = ch_main_scaffolded
+ quast_out = QC.out.quast_out
+ busco_out = QC.out.busco_out
+ merqury_report_files = QC.out.merqury_report_files
+}
diff --git a/subworkflows/local/scaffold/links/main.nf b/subworkflows/local/scaffold/links/main.nf
new file mode 100644
index 00000000..4e1ba95e
--- /dev/null
+++ b/subworkflows/local/scaffold/links/main.nf
@@ -0,0 +1,52 @@
+include { LINKS } from '../../../../modules/nf-core/links/main'
+include { QC } from '../../qc/main'
+include { LIFTOFF } from '../../../../modules/nf-core/liftoff/main'
+
+workflow RUN_LINKS {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+ ch_main.dump(tag: "SCAFFOLD: LINKS: WORKFLOW inputs")
+ ch_main
+ .multiMap { it ->
+ assembly: [it.meta, it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly]
+ reads: [it.meta, it.meta.qc_reads_path]
+ }
+ .set { links_in }
+
+ links_in.assembly.dump(tag: "SCAFFOLD: LINKS: Assembly inputs")
+ links_in.reads.dump(tag: "SCAFFOLD: LINKS: Read inputs")
+
+ LINKS(links_in.assembly, links_in.reads)
+ LINKS.out.scaffolds_fasta
+ .map { meta, scaff_links -> [meta: meta + [scaffolds_links: scaff_links] ] }
+ .set { ch_main_scaffolded }
+
+ QC(ch_main_scaffolded.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [assembly_map_bam: null] ]},
+ LINKS.out.scaffolds_fasta.map { meta, scaffold -> [meta.id, scaffold]},
+ meryl_kmers)
+
+ ch_main_scaffolded
+ .filter {
+ it -> it.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.scaffolds_links,
+ it.ref_fasta,
+ it.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in, [])
+
+ emit:
+ ch_main = ch_main_scaffolded
+ quast_out = QC.out.quast_out
+ busco_out = QC.out.busco_out
+ merqury_report_files = QC.out.merqury_report_files
+}
diff --git a/subworkflows/local/scaffold/longstitch/main.nf b/subworkflows/local/scaffold/longstitch/main.nf
new file mode 100644
index 00000000..76abf8d5
--- /dev/null
+++ b/subworkflows/local/scaffold/longstitch/main.nf
@@ -0,0 +1,59 @@
+include { LONGSTITCH } from '../../../../modules/local/longstitch/main'
+include { QC } from '../../qc/main'
+include { LIFTOFF } from '../../../../modules/nf-core/liftoff/main'
+
+workflow RUN_LONGSTITCH {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+ channel.empty().set { ch_versions }
+
+ ch_main
+ .map {
+ it ->
+ [
+ it.meta,
+ it.meta.polished ? (it.meta.polished.pilon ?: it.meta.polished.medaka ?: it.meta.polished.dorado) : it.meta.assembly,
+ it.meta.qc_reads_path,
+ it.meta.genome_size
+ ]
+ }
+ .set { longstitch_in }
+
+ longstitch_in.dump(tag: "SCAFFOLD: LONGSTITCH: inputs")
+
+ LONGSTITCH(longstitch_in)
+
+ LONGSTITCH.out.ntlLinks_arks_scaffolds
+ .map { meta, scaff_longst -> [meta: meta + [scaffolds_longstitch: scaff_longst] ] }
+ .set { ch_main_scaffolded }
+
+ QC(ch_main_scaffolded.map { it -> [ meta: it.meta - it.meta.subMap("assembly_map_bam") + [assembly_map_bam: null] ] },
+ LONGSTITCH.out.ntlLinks_arks_scaffolds.map { meta, scaffold -> [meta.id, scaffold]},
+ meryl_kmers)
+
+ ch_main_scaffolded
+ .filter {
+ it -> it.meta.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.scaffolds_longstitch,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in,[])
+
+ emit:
+ ch_main = ch_main_scaffolded
+ quast_out = QC.out.quast_out
+ busco_out = QC.out.busco_out
+ merqury_report_files = QC.out.merqury_report_files
+ versions = ch_versions
+}
diff --git a/subworkflows/local/scaffold/main.nf b/subworkflows/local/scaffold/main.nf
new file mode 100644
index 00000000..11647143
--- /dev/null
+++ b/subworkflows/local/scaffold/main.nf
@@ -0,0 +1,210 @@
+include { RUN_LINKS } from './links/main'
+include { RUN_LONGSTITCH } from './longstitch/main'
+include { RUN_RAGTAG } from './ragtag/main'
+include { HIC } from './hic/main'
+
+workflow SCAFFOLD {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+ channel.empty().set { links_busco }
+ channel.empty().set { links_quast }
+ channel.empty().set { links_merqury }
+ channel.empty().set { longstitch_busco }
+ channel.empty().set { longstitch_quast }
+ channel.empty().set { longstitch_merqury }
+ channel.empty().set { ragtag_busco }
+ channel.empty().set { ragtag_quast }
+ channel.empty().set { ragtag_merqury }
+
+ // There is no support for scaffolding of scaffolded scaffolds.
+ // But it is possible that one sample is scaffolded with different tools.
+ // Therefore main is filtered, instead of branched.
+
+ ch_main
+ .filter {
+ it -> it.meta.scaffold_links
+ }
+ .set { links_in }
+
+ RUN_LINKS(links_in, meryl_kmers)
+ RUN_LINKS.out.ch_main
+ .set { links_out }
+
+ ch_main
+ .filter {
+ it -> it.meta.scaffold_longstitch
+ }
+ .set { longstitch_in }
+
+ RUN_LONGSTITCH(longstitch_in, meryl_kmers)
+ RUN_LONGSTITCH.out.ch_main
+ .set { longstitch_out }
+
+ ch_main
+ .filter {
+ it -> it.meta.scaffold_hic
+ }
+ .set { hic_in }
+
+ HIC(hic_in, meryl_kmers)
+ HIC.out.ch_main
+ .set { hic_out }
+
+ ch_main
+ .filter {
+ it -> it.meta.scaffold_ragtag && !it.meta.hic_reads && !it.meta.scaffold_longstitch && !it.meta.scaffold_links
+ }
+ .mix(hic_out.filter { it -> it.meta.scaffold_ragtag } )
+ .mix(longstitch_out.filter { it -> it.meta.scaffold_ragtag } )
+ .mix(links_out.filter { it -> it.meta.scaffold_ragtag } )
+ .set { ragtag_in }
+
+ RUN_RAGTAG(ragtag_in, meryl_kmers)
+ RUN_RAGTAG.out.ch_main
+ .set { ragtag_out }
+
+ // Deal with cases that are single scaffold
+ links_out
+ .filter {it -> !it.meta.scaffold_longstitch && !it.meta.scaffold_ragtag }
+ .map { meta -> [ meta: meta - meta.subMap("links_scaffold") + [ scaffolds: [ links: meta.scaffolds_links ] ] ]}
+ .mix(
+ longstitch_out
+ .filter {it -> !it.meta.scaffold_links && !it.meta.scaffold_ragtag }
+ .map { meta -> [ meta: meta - meta.subMap("scaffolds_longstitch") + [ scaffolds: [ longstitch: meta.scaffolds_longstitch ] ] ]}
+ )
+ .mix(
+ ragtag_out
+ .filter {it -> !it.meta.scaffold_links && !it.meta.scaffold_longstitch }
+ .map { meta -> [ meta: meta - meta.subMap("scaffolds_ragtag") + [ scaffolds: [ ragtag: meta.scaffolds_ragtag ] ] ]}
+ )
+ .mix(
+ hic_out
+ .map { meta -> [ meta: meta - meta.subMap("scaffolds_hic") + [ scaffolds: [ hic: meta.scaffolds_hic ] ] ]}
+
+ )
+ // mix in those that are double scaffolded: , links-ragtag, longstitch-ragtag
+ // links-longstitch
+ .mix(
+ links_out
+ .filter {it -> it.meta.scaffold_longstitch && !it.meta.scaffold_ragtag }
+ .map {meta -> [meta.id, meta]}
+ // Join without filtering, inner-join
+ .join(
+ longstitch_out
+ .map {meta -> [meta.id, meta]}
+ )
+ .map {
+ _id, meta_links, meta_longstitch -> [
+ meta: meta_links -
+ meta_links.subMap("scaffolds_links") +
+ [scaffolds: [links: meta_links.scaffolds_links, longstitch: meta_longstitch.scaffolds_longstitch]] ]
+ }
+ )
+ //links-ragtag
+ .mix(
+ links_out
+ .filter {it -> !it.meta.scaffold_longstitch && it.meta.scaffold_ragtag }
+ .map {meta -> [meta.id, meta]}
+ // Join without filtering, inner-join
+ .join(
+ ragtag_out
+ .map {meta -> [meta.id, meta]}
+ )
+ .map {
+ _id, meta_links, meta_ragtag -> [
+ meta: meta_links -
+ meta_links.subMap("scaffolds_links") +
+ [scaffolds: [links: meta_links.scaffolds_links, ragtag: meta_ragtag.scaffolds_ragtag]] ]
+ }
+ )
+ //longstitch-ragtag
+ .mix(
+ longstitch_out
+ .filter {it -> !it.meta.scaffold_links && it.meta.scaffold_ragtag }
+ .map {meta -> [meta.id, meta]}
+ // Join without filtering, inner-join
+ .join(
+ ragtag_out
+ .map {meta -> [meta.id, meta]}
+ )
+ .map {
+ _id, meta_longstitch, meta_ragtag -> [
+ meta: meta_longstitch -
+ meta_longstitch.subMap("scaffolds_longstitch") +
+ [scaffolds: [longstitch: meta_longstitch.scaffolds_longstitch, ragtag: meta_ragtag.scaffolds_ragtag]] ]
+ }
+ )
+ // mix in triple-scaffolded
+ .mix(
+ links_out
+ .filter {it -> it.meta.scaffold_longstitch && it.meta.scaffold_ragtag }
+ .map {meta -> [meta.id, meta]}
+ // Join without filtering, inner-join
+ .join(
+ longstitch_out
+ .map {meta -> [meta.id, meta]}
+ )
+ .join(
+ ragtag_out
+ .map {meta -> [meta.id, meta]}
+ )
+ .map {
+ _id, meta_links, meta_longstitch, meta_ragtag -> [
+ meta: meta_links -
+ meta_links.subMap("scaffolds_links") +
+ [
+ scaffolds: [
+ links: meta_links.scaffolds_links,
+ longstitch: meta_longstitch.scaffolds_longstitch,
+ ragtag: meta_ragtag.scaffolds_ragtag
+ ]
+ ]
+ ]
+ }
+ )
+ .set { ch_main }
+
+
+ RUN_LINKS.out.busco_out.set { links_busco }
+ RUN_LINKS.out.quast_out.set { links_quast }
+ RUN_LINKS.out.merqury_report_files.set { links_merqury }
+
+ RUN_LONGSTITCH.out.busco_out.set { longstitch_busco }
+ RUN_LONGSTITCH.out.quast_out.set { longstitch_quast }
+ RUN_LONGSTITCH.out.merqury_report_files.set { longstitch_merqury }
+
+ HIC.out.busco_out.set { hic_busco }
+ HIC.out.quast_out.set { hic_quast }
+ HIC.out.merqury_report_files.set { hic_merqury }
+
+ RUN_RAGTAG.out.busco_out.set { ragtag_busco }
+ RUN_RAGTAG.out.quast_out.set { ragtag_quast }
+ RUN_RAGTAG.out.merqury_report_files.set { ragtag_merqury }
+
+ links_busco
+ .concat(longstitch_busco)
+ .concat(ragtag_busco)
+ .concat(hic_busco)
+ .set { scaffold_busco_reports }
+
+ links_quast
+ .concat(longstitch_quast)
+ .concat(ragtag_quast)
+ .concat(hic_quast)
+ .set { scaffold_quast_reports }
+
+ links_merqury
+ .concat(longstitch_merqury)
+ .concat(ragtag_merqury)
+ .concat(hic_merqury)
+ .set { scaffold_merqury_reports }
+
+ emit:
+ ch_main
+ scaffold_busco_reports
+ scaffold_quast_reports
+ scaffold_merqury_reports
+}
diff --git a/subworkflows/local/scaffold/ragtag/main.nf b/subworkflows/local/scaffold/ragtag/main.nf
new file mode 100644
index 00000000..27e7f951
--- /dev/null
+++ b/subworkflows/local/scaffold/ragtag/main.nf
@@ -0,0 +1,76 @@
+include { RAGTAG_SCAFFOLD } from '../../../../modules/nf-core/ragtag/scaffold/main'
+include { QC } from '../../qc/main'
+include { LIFTOFF } from '../../../../modules/nf-core/liftoff/main'
+
+
+workflow RUN_RAGTAG {
+ take:
+ ch_main
+ meryl_kmers
+
+ main:
+ ch_main
+ .multiMap { it ->
+ def assembly_to_scaffold =
+ it.meta.scaffold ?
+ (
+ it.meta.scaffolds_hic ?:
+ it.meta.scaffolds_longstitch ?:
+ it.meta.scaffolds_links
+ ) :
+ it.meta.polished ?
+ (
+ it.meta.polished.pilon ?:
+ it.meta.polished.medaka ?:
+ it.meta.polished.dorado
+ ) :
+ it.meta.assembly
+ assembly:
+ [
+ it.meta,
+ assembly_to_scaffold
+ ]
+ reference:
+ [
+ it.meta,
+ it.meta.ref_fasta
+ ]
+ }
+ .set { ragtag_in }
+
+ ragtag_in.assembly.dump(tag: "SCAFFOLD: RAGTAG: Assembly inputs")
+ ragtag_in.reference.dump(tag: "SCAFFOLD: RAGTAG: Reference inputs")
+
+ RAGTAG_SCAFFOLD(ragtag_in.assembly, ragtag_in.reference, [[], []], [[], [], []])
+
+ RAGTAG_SCAFFOLD.out.corrected_assembly
+ .map { meta, corrected -> [meta: meta + [ scaffolds_ragtag: corrected] ] }
+ .set { ch_main_scaffolded }
+
+ QC(ch_main_scaffolded.map { it -> [meta: it.meta - it.meta.subMap("assembly_map_bam") + [assembly_map_bam: null] ] },
+ RAGTAG_SCAFFOLD.out.corrected_assembly.map { meta, corrected -> [ meta.id, corrected ] },
+ meryl_kmers)
+
+
+ ch_main_scaffolded
+ .filter {
+ it -> it.lift_annotations
+ }
+ .map { it ->
+ [
+ it.meta,
+ it.meta.scaffolds_ragtag,
+ it.meta.ref_fasta,
+ it.meta.ref_gff
+ ]
+ }
+ .set { liftoff_in }
+
+ LIFTOFF(liftoff_in, [])
+
+ emit:
+ ch_main
+ quast_out = QC.out.quast_out
+ busco_out = QC.out.busco_out
+ merqury_report_files = QC.out.merqury_report_files
+}
diff --git a/subworkflows/local/scaffolding/links/main.nf b/subworkflows/local/scaffolding/links/main.nf
deleted file mode 100644
index 4493e4c4..00000000
--- a/subworkflows/local/scaffolding/links/main.nf
+++ /dev/null
@@ -1,47 +0,0 @@
-include { LINKS } from '../../../../modules/nf-core/links/main'
-include { QC } from '../../qc/main'
-include { RUN_LIFTOFF } from '../../liftoff/main'
-
-workflow RUN_LINKS {
- take:
- inputs
- in_reads
- assembly
- _references
- ch_aln_to_ref
- meryl_kmers
-
- main:
- Channel.empty().set { ch_versions }
-
- assembly
- .join(in_reads)
- .multiMap { meta, assembly_fa, reads ->
- assembly: [meta, assembly_fa]
- reads: [meta, reads]
- }
- .set { links_in }
-
- LINKS(links_in.assembly, links_in.reads)
- LINKS.out.scaffolds_fasta.set { scaffolds }
-
- ch_versions = ch_versions.mix(LINKS.out.versions)
-
- QC(inputs, in_reads, scaffolds, ch_aln_to_ref, meryl_kmers)
-
- ch_versions = ch_versions.mix(QC.out.versions)
-
- if (params.lift_annotations) {
- RUN_LIFTOFF(scaffolds, inputs)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
-
- versions = ch_versions
-
- emit:
- scaffolds
- quast_out = QC.out.quast_out
- busco_out = QC.out.busco_out
- merqury_report_files = QC.out.merqury_report_files
- versions
-}
diff --git a/subworkflows/local/scaffolding/longstitch/main.nf b/subworkflows/local/scaffolding/longstitch/main.nf
deleted file mode 100644
index 8756225d..00000000
--- a/subworkflows/local/scaffolding/longstitch/main.nf
+++ /dev/null
@@ -1,45 +0,0 @@
-include { LONGSTITCH } from '../../../../modules/local/longstitch/main'
-include { QC } from '../../qc/main'
-include { RUN_LIFTOFF } from '../../liftoff/main'
-
-workflow RUN_LONGSTITCH {
- take:
- inputs
- in_reads
- assembly
- _references
- ch_aln_to_ref
- meryl_kmers
- genome_size
-
- main:
- Channel.empty().set { ch_versions }
-
- assembly
- .join(in_reads)
- .join(genome_size)
- .set { longstitch_in }
- LONGSTITCH(longstitch_in)
-
- LONGSTITCH.out.ntlLinks_arks_scaffolds.set { scaffolds }
-
- ch_versions = ch_versions.mix(LONGSTITCH.out.versions)
-
- QC(inputs, in_reads, scaffolds, ch_aln_to_ref, meryl_kmers)
-
- ch_versions = ch_versions.mix(QC.out.versions)
-
- if (params.lift_annotations) {
- RUN_LIFTOFF(LONGSTITCH.out.ntlLinks_arks_scaffolds, inputs)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
-
- versions = ch_versions
-
- emit:
- scaffolds
- quast_out = QC.out.quast_out
- busco_out = QC.out.busco_out
- merqury_report_files = QC.out.merqury_report_files
- versions
-}
diff --git a/subworkflows/local/scaffolding/main.nf b/subworkflows/local/scaffolding/main.nf
deleted file mode 100644
index d816ff87..00000000
--- a/subworkflows/local/scaffolding/main.nf
+++ /dev/null
@@ -1,76 +0,0 @@
-include { RUN_LINKS } from './links/main'
-include { RUN_LONGSTITCH } from './longstitch/main'
-include { RUN_RAGTAG } from './ragtag/main'
-
-workflow SCAFFOLD {
- take:
- inputs
- in_reads
- assembly
- references
- ch_aln_to_ref
- meryl_kmers
- genome_size
-
- main:
- Channel.empty().set { ch_versions }
- Channel.empty().set { links_busco }
- Channel.empty().set { links_quast }
- Channel.empty().set { links_merqury }
- Channel.empty().set { longstitch_busco }
- Channel.empty().set { longstitch_quast }
- Channel.empty().set { longstitch_merqury }
- Channel.empty().set { ragtag_busco }
- Channel.empty().set { ragtag_quast }
- Channel.empty().set { ragtag_merqury }
-
- if (params.scaffold_links) {
- RUN_LINKS(inputs, in_reads, assembly, references, ch_aln_to_ref, meryl_kmers)
- RUN_LINKS.out.busco_out.set { links_busco }
- RUN_LINKS.out.quast_out.set { links_quast }
- RUN_LINKS.out.merqury_report_files.set { links_merqury }
-
- ch_versions = ch_versions.mix(RUN_LINKS.out.versions)
- }
-
- if (params.scaffold_longstitch) {
- RUN_LONGSTITCH(inputs, in_reads, assembly, references, ch_aln_to_ref, meryl_kmers, genome_size)
- RUN_LONGSTITCH.out.busco_out.set { longstitch_busco }
- RUN_LONGSTITCH.out.quast_out.set { longstitch_quast }
- RUN_LONGSTITCH.out.merqury_report_files.set { longstitch_merqury }
-
- ch_versions = ch_versions.mix(RUN_LONGSTITCH.out.versions)
- }
-
- if (params.scaffold_ragtag) {
- RUN_RAGTAG(inputs, in_reads, assembly, references, ch_aln_to_ref, meryl_kmers)
- RUN_RAGTAG.out.busco_out.set { ragtag_busco }
- RUN_RAGTAG.out.quast_out.set { ragtag_quast }
- RUN_RAGTAG.out.merqury_report_files.set { ragtag_merqury }
-
- ch_versions = ch_versions.mix(RUN_RAGTAG.out.versions)
- }
-
- links_busco
- .concat(longstitch_busco)
- .concat(ragtag_busco)
- .set { scaffold_busco_reports }
-
- links_quast
- .concat(longstitch_quast)
- .concat(ragtag_quast)
- .set { scaffold_quast_reports }
-
- links_merqury
- .concat(longstitch_merqury)
- .concat(ragtag_merqury)
- .set { scaffold_merqury_reports }
-
- versions = ch_versions
-
- emit:
- scaffold_busco_reports
- scaffold_quast_reports
- scaffold_merqury_reports
- versions
-}
diff --git a/subworkflows/local/scaffolding/ragtag/main.nf b/subworkflows/local/scaffolding/ragtag/main.nf
deleted file mode 100644
index 518afb87..00000000
--- a/subworkflows/local/scaffolding/ragtag/main.nf
+++ /dev/null
@@ -1,52 +0,0 @@
-include { RAGTAG_SCAFFOLD } from '../../../../modules/nf-core/ragtag/scaffold/main'
-include { QC } from '../../qc/main'
-include { RUN_LIFTOFF } from '../../liftoff/main'
-
-
-workflow RUN_RAGTAG {
- take:
- inputs
- in_reads
- assembly
- references
- ch_aln_to_ref
- meryl_kmers
-
- main:
- Channel.empty().set { ch_versions }
-
- assembly
- .join(references)
- .multiMap { meta, assembly_fasta, reference_fasta ->
- assembly: [meta, assembly_fasta]
- reference: [meta, reference_fasta]
- }
- .set { ragtag_in }
-
- RAGTAG_SCAFFOLD(ragtag_in.assembly, ragtag_in.reference, [[], []], [[], [], []])
-
- RAGTAG_SCAFFOLD.out.corrected_assembly.set { ragtag_scaffold_fasta }
-
- RAGTAG_SCAFFOLD.out.corrected_agp.set { ragtag_scaffold_agp }
-
- ch_versions = ch_versions.mix(RAGTAG_SCAFFOLD.out.versions)
-
- QC(inputs, in_reads, ragtag_scaffold_fasta, ch_aln_to_ref, meryl_kmers)
-
- ch_versions = ch_versions.mix(QC.out.versions)
-
- if (params.lift_annotations) {
- RUN_LIFTOFF(RAGTAG_SCAFFOLD.out.corrected_assembly, inputs)
- ch_versions = ch_versions.mix(RUN_LIFTOFF.out.versions)
- }
-
- versions = ch_versions
-
- emit:
- ragtag_scaffold_fasta
- ragtag_scaffold_agp
- quast_out = QC.out.quast_out
- busco_out = QC.out.busco_out
- merqury_report_files = QC.out.merqury_report_files
- versions
-}
diff --git a/subworkflows/local/utils_nfcore_genomeassembler_pipeline/main.nf b/subworkflows/local/utils_nfcore_genomeassembler_pipeline/main.nf
index 29aee94e..c452d4a4 100644
--- a/subworkflows/local/utils_nfcore_genomeassembler_pipeline/main.nf
+++ b/subworkflows/local/utils_nfcore_genomeassembler_pipeline/main.nf
@@ -95,50 +95,220 @@ workflow PIPELINE_INITIALISATION {
// Create channel from input file provided through params.input
//
- Channel.empty().set { ch_refs }
- Channel.fromPath(params.input)
+ channel.fromPath(params.input)
.splitCsv(header: true)
- .map { it -> [meta: [id: it.sample], ontreads: it.ontreads, hifireads: it.hifireads, ref_fasta: it.ref_fasta, ref_gff: it.ref_gff, shortread_F: it.shortread_F, shortread_R: it.shortread_R, paired: it.paired] }
- .set { ch_samplesheet }
- if (params.use_ref) {
- ch_samplesheet
- .map { it -> [it.meta, file(it.ref_fasta, checkIfExists: true)] }
- .set { ch_refs }
- }
- if (params.lift_annotations) {
- ch_samplesheet
- .map { it -> [it.meta, file(it.ref_gff, checkIfExists: true)] }
- }
- // check for assembler / read combination
- def hifi_only = params.hifi && !params.ont ? true : false
- if (!params.skip_assembly) {
- if (params.assembler == "flye") {
- if (params.hifi) {
- if (!hifi_only) {
- error('Cannot combine hifi and ont reads with flye')
- }
- }
+ /*
+ This is a somewhat crucial step, where the samplesheet and params are used to determine per-sample parameters.
+ */
+ .map { it ->
+ def strategy = it.strategy ?: params.strategy
+
+ def ontreads = it.ontreads ?: params.ontreads
+
+ def hifireads = it.hifireads ?: params.hifireads
+
+ def assembler = it.assembler ?: params.assembler
+
+ def assembler_ont = it.assembler_ont ?:
+ (strategy == "single" && assembler && ontreads && !hifireads) ? assembler :
+ params.assembler_ont ?:
+ (strategy == "hybrid" && assembler == "hifiasm") ? assembler :
+ assembler.contains("_") ? assembler.tokenize("_")[0] :
+ null
+
+ def assembler_hifi = it.assembler_hifi ?:
+ (strategy == "single" && assembler && hifireads && !ontreads) ? assembler :
+ params.assembler_hifi ?:
+ assembler.contains("_") ? assembler.tokenize("_")[1] :
+ null
+
+ def polish = it.polish ?:
+ (params.polish_medaka && params.polish_dorado) ? error("Both polish_medaka and polish_dorado are set.") :
+ (params.polish_medaka && params.polish_pilon && ontreads) ? "medaka+pilon" :
+ (params.polish_dorado && params.polish_pilon && ontreads) ? "dorado+pilon" :
+ (params.polish_medaka && ontreads) ? "medaka" :
+ (params.polish_dorado && ontreads) ? "dorado" :
+ (params.polish_pilon && (it.shortread_F || params.shortread_F)) ? "pilon" :
+ null
+
+ def hic_F = it.hic_F ?: params.hic_F
+
+ def scaffold_hic = hic_F ? (it.scaffold_hic != null ? it.scaffold_hic : params.scaffold_hic) : false
+
+ def hic_trim = !scaffold_hic ? false :
+ (it.hic_trim ?: params.hic_trim)
+
+ def assembler_ont_args = it.assembler_ont_args ?: params.assembler_ont_args ?: ''
+ def assembler_hifi_args = it.assembler_hifi_args ?: params.assembler_hifi_args ?: ''
+
+ // Check if strategy can be inferred
+ strategy == "single" && ontreads && hifireads && !((!assembler_ont && assembler_hifi) || (assembler_ont && !assembler_hifi)) ?
+ error(
+ """
+ [$it.sample]: Strategy is 'single', but ONT and HiFi reads are provided.
+ Please unambigiously define either 'assembler_ont' for ONT or 'assembler_hifi' for HiFi
+ """
+ ) :
+ null
+
+ // Build the map. Everything goes into meta.
+ [
+ meta: [
+ id: it.sample,
+ // new in refactor-assemblies
+ group: it.group ?: null,
+ ontreads: ontreads,
+ hifireads: hifireads,
+ // new in refactor-assemblers
+ strategy: strategy,
+ // The "assembler" value is mainly to ease input, all actual workflow logic should use assembler_ont/_hifi.
+ assembler: assembler,
+ assembler_ont: assembler_ont,
+ assembler_hifi: assembler_hifi,
+ assembly_scaffolding_order: it.assembly_scaffolding_order ?: params.assembly_scaffolding_order ?: "ont_on_hifi",
+ assembler_ont_args: assembler_ont_args,
+ assembler_hifi_args: assembler_hifi_args,
+ hifiasm_args: it.hifiasm_args ?: params.hifiasm_args,
+ flye_args: it.flye_args ?: params.flye_args,
+ polish: polish,
+ ont_collect: it.ont_collect ?: params.ont_collect,
+ ont_adapters: it.ont_adapters ?: params.ont_adapters,
+ ont_fastplong_args: it.ont_fastplong_args ?: params.ont_fastplong_args,
+ jellyfish: it.jellyfish ?: params.jellyfish,
+ jellyfish_k: it.ont_jellyfish_k ?: params.jellyfish_k,
+ hifi_adapters: it.hifi_adapters ?: params.hifi_adapters,
+ hifi_fastplong_args: it.hifi_fastplong_args ?: params.hifi_fastplong_args,
+ medaka_model: it.medaka_model ?: params.medaka_model,
+ scaffold_longstitch: it.scaffold_longstitch ?: params.scaffold_longstitch,
+ scaffold_links: it.scaffold_links ?: params.scaffold_links,
+ scaffold_ragtag: it.scaffold_ragtag ?: params.scaffold_ragtag,
+ scaffold_hic: scaffold_hic,
+ use_ref: it.use_ref ?: params.use_ref,
+ // hic
+ hic_aligner: it.hic_aligner ?: params.hic_aligner,
+ hic_F: scaffold_hic ? (hic_F) : [],
+ hic_R: scaffold_hic ? (it.hic_R ?: params.hic_R) : [],
+ hic_trim: hic_trim,
+ // not new
+ genome_size: it.genome_size ?: params.genome_size,
+ ref_fasta: it.ref_fasta ?: params.ref_fasta,
+ ref_gff: it.ref_gff ?: params.ref_gff,
+ flye_mode: it.flye_mode ?: params.flye_mode,
+ // assembly already provided?
+ assembly: it.assembly ?: params.assembly ?: null,
+ // ref mapping provided?
+ ref_map_bam: it.ref_map_bam ?: params.ref_map_bam ?: null,
+ // assembly mapping provided
+ assembly_map_bam: it.assembly_map_bam ?: params.ref_map_bam ?: null,
+ // reads for qc
+ qc_reads: ((it.qc_reads == "ont" || params.qc_reads == "ont") && ontreads) ? "ont" : "hifi",
+ qc_reads_path: ((it.qc_reads == "ont" || params.qc_reads == "ont") && ontreads) ? ontreads : hifireads,
+ quast: it.quast ?: params.quast,
+ busco: it.busco ?: params.busco,
+ busco_lineage: it.busco_lineage ?: params.busco_lineage,
+ busco_db: it.busco_db ?: params.busco_db,
+ meryl_k: it.meryl_k ?: params.meryl_k,
+ merqury: it.merqury ?: params.merqury,
+ lift_annotations: (it.ref_gff || params.ref_gff) ? (it.lift_annotations ?: params.lift_annotations) : false,
+ shortread_F: it.shortread_F ?: params.shortread_F,
+ shortread_R: it.shortread_R ?: params.shortread_R,
+ paired: it.paired ?: params.paired ?: ((it.shortread_F || params.shortread_F) && (it.shortread_R || params.shortread_R)) ? true : false,
+ // new:
+ use_short_reads: it.use_short_reads ?: params.use_short_reads ?: params.shortread_F ? true : (it.shortread_F ? true : false),
+ shortread_trim: it.shortread_trim ?: params.shortread_trim
+ ]
+ ]
}
- }
- // check for QC reads
- if (params.hifi && params.ont) {
- if (!params.qc_reads) {
- error("Please specify which reads should be used for qc: 'ONT' or 'HIFI'")
+ .set { ch_samplesheet }
+
+ // Define valid hybrid assemblers
+
+ def hybrid_assemblers = ["hifiasm"]
+ ch_samplesheet.dump(tag: "PARSED INPUTS:")
+ // sample-level checks
+ // if a check fails, map returns a list that prints what fails, and contains "invalid"
+ // error is raised by subscribe if there is more than one "invalid"
+ /*
+ ch_samplesheet
+ .map {
+ it ->
+ [
+ // Check if assembler_ont was set
+ (it.meta.ontreads && !it.meta.assembler_ont && !it.meta.assembly)
+ ?
+ (
+ // Check if assembler_hifi was set
+ (it.meta.hifireads && it.meta.assembler_hifi && it.meta.stragegy == "single")
+ ?
+ null
+ :
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: assembler_ont could not be set and no assembly was provided."),
+ "invalid"
+ ]
+ )
+ : null,
+ // Check if assembler_hifi was set
+ (it.meta.hifireads && !it.meta.assembler_hifi && !it.meta.assembly)
+ ?
+ (
+ // Check if assembler_ont was set
+ (it.meta.ontreads && it.meta.assembler_ont && it.meta.stragegy == "single")
+ ?
+ null
+ :
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: assembler_hifi could not be set and no assembly was provided."),
+ "invalid"
+ ]
+ )
+ : null,
+ // Check if reads and strategy match
+ (it.meta.strategy == "single" && it.meta.ontreads && it.meta.hifireads)
+ ?
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: Strategy is $it.meta.strategy, but both types of reads are provided."),
+ "invalid"
+ ]
+ : null,
+ // Check if assembler can do hybrid
+ (it.meta.strategy == "hybrid" && !hybrid_assemblers.contains(it.meta.assembler_ont))
+ ?
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: Hybrid assembly can only be performed with $hybrid_assemblers"),
+ "invalid"
+ ]
+ : null,
+ // Check if qc reads are specified for hybrid assemblies
+ (it.meta.strategy == "hybrid" && !it.meta.qc_reads)
+ ?
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: Please specify which reads should be used for qc: '--qc_reads': 'ont' or 'hifi'"),
+ "invalid"
+ ]
+ : null,
+ // Check if genome_size is given with --scaffold_longstitch
+ (it.meta.scaffold_longstitch && !it.meta.genome_size && !it.meta.jellyfish)
+ ?
+ [
+ println("Please confirm samplesheet: [sample: $it.meta.id]: scaffolding with longstitch requires genome-size. Either provide genome-size estimate, or estimate from reads with --jellyfish"),
+ "invalid"
+ ]
+ : null,
+ ]
}
- }
- // Make sure that genome_size is provided or estimated when using scaffold_longstitch
- if (params.scaffold_longstitch) {
- // If genomesize is not provided, and if ONT is not used in combination with jellyfish
- // Throw an error
- if (!params.genome_size && (!params.ont && !params.jellyfish)) {
- error("Scaffolding with longstitch requires genome size.\n Either provide a genome size with --genome_size or estimate from ONT reads using jellyfish and genomescope")
+ .map { it -> it.collect() }
+ .collect()
+ // warn if >0 samples failed a check above
+ .subscribe {
+ it -> it.contains("invalid")
+ ? log.warn("Invalid combination in samplesheet")
+ : null
}
- }
-
+ */
emit:
samplesheet = ch_samplesheet
- refs = ch_refs
versions = ch_versions
}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
index b716375b..312c2d24 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/main.nf
@@ -12,14 +12,9 @@ workflow BAM_SORT_STATS_SAMTOOLS {
ch_fasta // channel: [ val(meta), path(fasta) ]
main:
-
- ch_versions = Channel.empty()
-
- SAMTOOLS_SORT ( ch_bam, ch_fasta )
- ch_versions = ch_versions.mix(SAMTOOLS_SORT.out.versions.first())
+ SAMTOOLS_SORT ( ch_bam, ch_fasta, '' )
SAMTOOLS_INDEX ( SAMTOOLS_SORT.out.bam )
- ch_versions = ch_versions.mix(SAMTOOLS_INDEX.out.versions.first())
SAMTOOLS_SORT.out.bam
.join(SAMTOOLS_INDEX.out.bai, by: [0], remainder: true)
@@ -35,7 +30,6 @@ workflow BAM_SORT_STATS_SAMTOOLS {
.set { ch_bam_bai }
BAM_STATS_SAMTOOLS ( ch_bam_bai, ch_fasta )
- ch_versions = ch_versions.mix(BAM_STATS_SAMTOOLS.out.versions)
emit:
bam = SAMTOOLS_SORT.out.bam // channel: [ val(meta), [ bam ] ]
@@ -45,6 +39,4 @@ workflow BAM_SORT_STATS_SAMTOOLS {
stats = BAM_STATS_SAMTOOLS.out.stats // channel: [ val(meta), [ stats ] ]
flagstat = BAM_STATS_SAMTOOLS.out.flagstat // channel: [ val(meta), [ flagstat ] ]
idxstats = BAM_STATS_SAMTOOLS.out.idxstats // channel: [ val(meta), [ idxstats ] ]
-
- versions = ch_versions // channel: [ versions.yml ]
}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
index 821a3cf5..c5841289 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test
@@ -41,8 +41,7 @@ nextflow_workflow {
{ assert snapshot(
workflow.out.flagstat,
workflow.out.idxstats,
- workflow.out.stats,
- workflow.out.versions).match() }
+ workflow.out.stats).match() }
)
}
}
@@ -72,8 +71,7 @@ nextflow_workflow {
{ assert snapshot(
workflow.out.flagstat,
workflow.out.idxstats,
- workflow.out.stats,
- workflow.out.versions).match() }
+ workflow.out.stats).match() }
)
}
}
diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
index c3c9a049..f62d68c9 100644
--- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap
@@ -25,22 +25,15 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,2fe0f3a7a1f07906061c1dadb62e0d05"
+ "test.stats:md5,1101fe711c4a389fdb5c4a1532107d1f"
]
- ],
- [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
]
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:26:24.36986488"
+ "timestamp": "2026-02-03T11:33:01.647190952"
},
"test_bam_sort_stats_samtools_paired_end": {
"content": [
@@ -68,22 +61,15 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,ba007b13981dad548358c7c957d41e12"
+ "test.stats:md5,f26c554c244ee86c89d62ebed509fd95"
]
- ],
- [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
]
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:26:38.683996037"
+ "timestamp": "2026-02-03T11:33:08.706742267"
},
"test_bam_sort_stats_samtools_single_end - stub": {
"content": [
@@ -124,7 +110,7 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"5": [
@@ -136,13 +122,6 @@
"test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "6": [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
- ],
"bai": [
[
{
@@ -170,7 +149,7 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"idxstats": [
@@ -190,21 +169,14 @@
},
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- "versions": [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:07:18.896460047"
+ "timestamp": "2026-02-03T11:11:02.1412136"
},
"test_bam_sort_stats_samtools_paired_end - stub": {
"content": [
@@ -245,7 +217,7 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"5": [
@@ -257,13 +229,6 @@
"test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "6": [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
- ],
"bai": [
[
{
@@ -291,7 +256,7 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"idxstats": [
@@ -311,20 +276,13 @@
},
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- "versions": [
- "versions.yml:md5,032c89015461d597fcc5a5331b619d0a",
- "versions.yml:md5,416c5e4a374c61167db999b0e400e3cf",
- "versions.yml:md5,721391fd94c417808516480c9451c6fd",
- "versions.yml:md5,9e12386b91a2977d23292754e3bcb522",
- "versions.yml:md5,c294c162aeb09862cc5e55b602647452"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:07:39.028688324"
+ "timestamp": "2026-02-03T11:11:09.165267895"
}
}
\ No newline at end of file
diff --git a/subworkflows/nf-core/bam_stats_samtools/main.nf b/subworkflows/nf-core/bam_stats_samtools/main.nf
index 44d4c010..34e8fe10 100644
--- a/subworkflows/nf-core/bam_stats_samtools/main.nf
+++ b/subworkflows/nf-core/bam_stats_samtools/main.nf
@@ -12,21 +12,14 @@ workflow BAM_STATS_SAMTOOLS {
ch_fasta // channel: [ val(meta), path(fasta) ]
main:
- ch_versions = Channel.empty()
-
SAMTOOLS_STATS ( ch_bam_bai, ch_fasta )
- ch_versions = ch_versions.mix(SAMTOOLS_STATS.out.versions)
SAMTOOLS_FLAGSTAT ( ch_bam_bai )
- ch_versions = ch_versions.mix(SAMTOOLS_FLAGSTAT.out.versions)
SAMTOOLS_IDXSTATS ( ch_bam_bai )
- ch_versions = ch_versions.mix(SAMTOOLS_IDXSTATS.out.versions)
emit:
stats = SAMTOOLS_STATS.out.stats // channel: [ val(meta), path(stats) ]
flagstat = SAMTOOLS_FLAGSTAT.out.flagstat // channel: [ val(meta), path(flagstat) ]
idxstats = SAMTOOLS_IDXSTATS.out.idxstats // channel: [ val(meta), path(idxstats) ]
-
- versions = ch_versions // channel: [ path(versions.yml) ]
}
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
index 76e7a40a..2f329695 100644
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test
@@ -36,8 +36,7 @@ nextflow_workflow {
{ assert snapshot(
workflow.out.flagstat,
workflow.out.idxstats,
- workflow.out.stats,
- workflow.out.versions).match() }
+ workflow.out.stats).match() }
)
}
}
@@ -66,8 +65,7 @@ nextflow_workflow {
{ assert snapshot(
workflow.out.flagstat,
workflow.out.idxstats,
- workflow.out.stats,
- workflow.out.versions).match() }
+ workflow.out.stats).match() }
)
}
}
@@ -96,8 +94,7 @@ nextflow_workflow {
{ assert snapshot(
workflow.out.flagstat,
workflow.out.idxstats,
- workflow.out.stats,
- workflow.out.versions).match() }
+ workflow.out.stats).match() }
)
}
}
diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
index 8ca22526..9c8ff1b5 100644
--- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
+++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap
@@ -17,7 +17,7 @@
"id": "test",
"single_end": true
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"2": [
@@ -29,18 +29,13 @@
"test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "3": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
- ],
"flagstat": [
[
{
"id": "test",
"single_end": true
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"idxstats": [
@@ -60,19 +55,14 @@
},
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- "versions": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:08:35.660286921"
+ "timestamp": "2026-02-03T11:10:30.076183827"
},
"test_bam_stats_samtools_single_end - stub": {
"content": [
@@ -92,7 +82,7 @@
"id": "test",
"single_end": true
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"2": [
@@ -104,18 +94,13 @@
"test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "3": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
- ],
"flagstat": [
[
{
"id": "test",
"single_end": true
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"idxstats": [
@@ -135,19 +120,14 @@
},
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- "versions": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:08:24.220305512"
+ "timestamp": "2026-02-03T11:10:24.379362883"
},
"test_bam_stats_samtools_paired_end_cram - stub": {
"content": [
@@ -167,7 +147,7 @@
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"2": [
@@ -179,18 +159,13 @@
"test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
],
- "3": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
- ],
"flagstat": [
[
{
"id": "test",
"single_end": false
},
- "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test.flagstat:md5,67394650dbae96d1a4fcc70484822159"
]
],
"idxstats": [
@@ -210,19 +185,14 @@
},
"test.stats:md5,d41d8cd98f00b204e9800998ecf8427e"
]
- ],
- "versions": [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
}
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:08:54.206770141"
+ "timestamp": "2026-02-03T11:10:35.91658956"
},
"test_bam_stats_samtools_single_end": {
"content": [
@@ -250,20 +220,15 @@
"id": "test",
"single_end": true
},
- "test.stats:md5,291bb2393ec947140d12d42c2795b222"
+ "test.stats:md5,7a05a22bdb17e8df6e8c2d100ff09a31"
]
- ],
- [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:07:49.731645858"
+ "timestamp": "2026-02-03T11:32:20.243663217"
},
"test_bam_stats_samtools_paired_end": {
"content": [
@@ -291,20 +256,15 @@
"id": "test",
"single_end": true
},
- "test.stats:md5,8140d69cdedd77570ca1d7618a744e16"
+ "test.stats:md5,a391612b5ef5b181e854ccaad8c8a068"
]
- ],
- [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:08:01.421996172"
+ "timestamp": "2026-02-03T11:32:26.434187887"
},
"test_bam_stats_samtools_paired_end_cram": {
"content": [
@@ -332,19 +292,14 @@
"id": "test",
"single_end": false
},
- "test.stats:md5,1622856127bafd6cdbadee9cd64ec9b7"
+ "test.stats:md5,2b0e31ab01b867a6ff312023ae03838d"
]
- ],
- [
- "versions.yml:md5,73c55059ed478cd2f9cd93dd3185da3a",
- "versions.yml:md5,80d8653e01575b3c381d87073f672fb5",
- "versions.yml:md5,cb889532237a2f3d813978ac14a12d51"
]
],
"meta": {
- "nf-test": "0.9.0",
- "nextflow": "24.04.4"
+ "nf-test": "0.9.3",
+ "nextflow": "25.10.3"
},
- "timestamp": "2024-09-16T08:08:12.640915756"
+ "timestamp": "2026-02-03T11:32:32.441454186"
}
}
\ No newline at end of file
diff --git a/tests/.nftignore b/tests/.nftignore
index e8128b21..c31dce4d 100644
--- a/tests/.nftignore
+++ b/tests/.nftignore
@@ -1,6 +1,16 @@
.DS_Store
fastqc/*_fastqc.{html,zip}
pipeline_info/*.{html,json,txt,yml}
-*/*/*/*.{log,bin,gz,gff3,fasta,agp}
-*/*/*.{log,bin,gz,gff3,txt}
+*/*/*/*/*.{log,bin,gff3,agp,html,gz}
+*/*/*/*.{log,bin,gff3,agp,html,gz}
+*/*/*.{log,bin,gz,gff3,agp,html,gz}
+*/*.{log,bin,gz,gff3,agp,html,gz}
+*.{log,bin,gz,gff3,agp,html,gz}
*/*/*/*.assembly_info.txt
+*/scaffold/longstitch/*tigmint-ntLink-arks.fa
+test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.comps.fasta
+test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.ctg.fasta
+test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.patch.fasta
+test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.patch.fasta
+test_flye_hifiasm/scaffold/ragtag/test_flye_hifiasm_ragtag.fasta
+test_flye_hifiasm/scaffold/ragtag/test_flye_hifiasm_ragtag.stats
diff --git a/tests/default.nf.test b/tests/default.nf.test
index 67fb220f..3fa9782d 100644
--- a/tests/default.nf.test
+++ b/tests/default.nf.test
@@ -16,14 +16,17 @@ nextflow_pipeline {
// stable_name: All files + folders in ${params.outdir}/ with a stable name
def stable_name = getAllFilesFromDir(params.outdir, relative: true, includeDir: true, ignore: ['pipeline_info/*.{html,json,txt}'])
// stable_path: All files in ${params.outdir}/ with stable content
- def stable_path = getAllFilesFromDir(params.outdir, ignoreFile: 'tests/.nftignore')
+ def stable_path = getAllFilesFromDir(
+ params.outdir,
+ ignoreFile: 'tests/.nftignore',
+ )
assertAll(
{ assert workflow.success},
{ assert snapshot(
// Number of successful tasks
workflow.trace.succeeded().size(),
// pipeline versions.yml file for multiqc from which Nextflow version is removed because we test pipelines on multiple Nextflow versions
- removeNextflowVersion("$outputDir/pipeline_info/nf_core_genomeassembler_software_versions.yml"),
+ removeNextflowVersion("$outputDir/pipeline_info/nf_core_pipeline_software_versions.yml"),
// All stable path name, with a relative path
stable_name,
// All files with stable contents
diff --git a/tests/default.nf.test.snap b/tests/default.nf.test.snap
index 73ab05f2..67008918 100644
--- a/tests/default.nf.test.snap
+++ b/tests/default.nf.test.snap
@@ -1,89 +1,345 @@
{
"-profile test": {
"content": [
- 6,
+ 39,
{
- "FLYE": {
+ "FASTPLONG_HIFI": {
+ "fastplong": "0.3.0"
+ },
+ "FASTPLONG_ONT": {
+ "fastplong": "0.3.0"
+ },
+ "FLYE_HIFI": {
+ "flye": "2.9.5-b1801"
+ },
+ "FLYE_ONT": {
"flye": "2.9.5-b1801"
},
"GFA_2_FA_HIFI": {
- "awk": "mawk 1.3.4",
- "gzip": 1.13
+ "bgzip": "1.22.1"
+ },
+ "GFA_2_FA_ONT": {
+ "bgzip": "1.22.1"
},
"HIFIASM": {
- "hifiasm": "0.25.0-r726"
+ "hifasm": "0.25.0-r726"
+ },
+ "HIFIASM_ONT": {
+ "hifasm": "0.25.0-r726"
},
"LIFTOFF": {
- "liftoff": "v1.6.3"
+ "liftoff": "1.6.3"
},
- "NANOQ": {
- "nanoq": "0.10.0"
+ "LONGSTITCH": {
+ "LongStitch": "1.0.5"
},
"RAGTAG_PATCH": {
"ragtag": "2.1.0"
},
- "Workflow": {
- "nf-core/genomeassembler": "v1.1.0"
+ "RAGTAG_SCAFFOLD": {
+ "ragtag": "2.1.0"
}
},
[
- "Col-0_2MB",
- "Col-0_2MB/QC",
- "Col-0_2MB/QC/nanoq",
- "Col-0_2MB/QC/nanoq/Col-0_2MB_report.json",
- "Col-0_2MB/QC/nanoq/Col-0_2MB_stats.json",
- "Col-0_2MB/assembly",
- "Col-0_2MB/assembly/Col-0_2MB_assembly.gff3",
- "Col-0_2MB/assembly/Col-0_2MB_assembly.unmapped.txt",
- "Col-0_2MB/assembly/flye",
- "Col-0_2MB/assembly/flye/Col-0_2MB.assembly.fasta.gz",
- "Col-0_2MB/assembly/flye/Col-0_2MB.assembly_graph.gfa.gz",
- "Col-0_2MB/assembly/flye/Col-0_2MB.assembly_graph.gv.gz",
- "Col-0_2MB/assembly/flye/Col-0_2MB.assembly_info.txt",
- "Col-0_2MB/assembly/flye/Col-0_2MB.flye.log",
- "Col-0_2MB/assembly/flye/Col-0_2MB.params.json",
- "Col-0_2MB/assembly/hifiasm",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.bp.hap1.p_ctg.gfa",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.bp.hap2.p_ctg.gfa",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.bp.p_ctg.gfa",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.bp.p_utg.gfa",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.bp.r_utg.gfa",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.ec.bin",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.ovlp.reverse.bin",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.ovlp.source.bin",
- "Col-0_2MB/assembly/hifiasm/Col-0_2MB.stderr.log",
- "Col-0_2MB/assembly/hifiasm/fasta",
- "Col-0_2MB/assembly/hifiasm/fasta/Col-0_2MB.bp.p_utg.fa.gz",
- "Col-0_2MB/assembly/ragtag",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.comps.fasta",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.ctg.agp",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.ctg.fasta",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.patch.agp",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.patch.err",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.patch.fasta",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.rename.agp",
- "Col-0_2MB/assembly/ragtag/Col-0_2MB_assembly_patch.rename.fasta",
"pipeline_info",
- "pipeline_info/nf_core_genomeassembler_software_versions.yml",
- "pipeline_info/nf_core_pipeline_software_versions.yml"
+ "pipeline_info/nf_core_pipeline_software_versions.yml",
+ "test_flye_hifiasm",
+ "test_flye_hifiasm/assembly",
+ "test_flye_hifiasm/assembly/flye",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.assembly.fasta.gz",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.assembly_graph.gfa.gz",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.assembly_graph.gv.gz",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.assembly_info.txt",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.flye.log",
+ "test_flye_hifiasm/assembly/flye/test_flye_hifiasm.params.json",
+ "test_flye_hifiasm/assembly/hifiasm",
+ "test_flye_hifiasm/assembly/hifiasm/fasta",
+ "test_flye_hifiasm/assembly/hifiasm/fasta/test_flye_hifiasm.bp.p_ctg.fa.gz",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.bp.hap1.p_ctg.gfa",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.bp.hap2.p_ctg.gfa",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.bp.p_ctg.gfa",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.bp.p_utg.gfa",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.bp.r_utg.gfa",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.ec.bin",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.ovlp.reverse.bin",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.ovlp.source.bin",
+ "test_flye_hifiasm/assembly/hifiasm/test_flye_hifiasm.stderr.log",
+ "test_flye_hifiasm/assembly/ragtag",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.comps.fasta",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.ctg.agp",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.ctg.fasta",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.patch.agp",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.patch.err",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.patch.fasta",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.rename.agp",
+ "test_flye_hifiasm/assembly/ragtag/test_flye_hifiasm_assembly_patch.rename.fasta",
+ "test_flye_hifiasm/assembly/test_flye_hifiasm_assembly.gff3",
+ "test_flye_hifiasm/assembly/test_flye_hifiasm_assembly.unmapped.txt",
+ "test_flye_hifiasm/reads",
+ "test_flye_hifiasm/reads/fastplong",
+ "test_flye_hifiasm/reads/fastplong/hifi",
+ "test_flye_hifiasm/reads/fastplong/hifi/test_flye_hifiasm_hifi.fastplong.fastq.gz",
+ "test_flye_hifiasm/reads/fastplong/hifi/test_flye_hifiasm_hifi.fastplong.html",
+ "test_flye_hifiasm/reads/fastplong/hifi/test_flye_hifiasm_hifi.fastplong.json",
+ "test_flye_hifiasm/reads/fastplong/hifi/test_flye_hifiasm_hifi.fastplong.log",
+ "test_flye_hifiasm/reads/fastplong/ont",
+ "test_flye_hifiasm/reads/fastplong/ont/test_flye_hifiasm_ont.fastplong.fastq.gz",
+ "test_flye_hifiasm/reads/fastplong/ont/test_flye_hifiasm_ont.fastplong.html",
+ "test_flye_hifiasm/reads/fastplong/ont/test_flye_hifiasm_ont.fastplong.json",
+ "test_flye_hifiasm/reads/fastplong/ont/test_flye_hifiasm_ont.fastplong.log",
+ "test_flye_hifiasm/scaffold",
+ "test_flye_hifiasm/scaffold/ragtag",
+ "test_flye_hifiasm/scaffold/ragtag/test_flye_hifiasm_ragtag.agp",
+ "test_flye_hifiasm/scaffold/ragtag/test_flye_hifiasm_ragtag.fasta",
+ "test_flye_hifiasm/scaffold/ragtag/test_flye_hifiasm_ragtag.stats",
+ "test_hifi_flye",
+ "test_hifi_flye/reads",
+ "test_hifi_flye/reads/fastplong",
+ "test_hifi_flye/reads/fastplong/hifi",
+ "test_hifi_flye/reads/fastplong/hifi/test_hifi_flye_hifi.fastplong.fastq.gz",
+ "test_hifi_flye/reads/fastplong/hifi/test_hifi_flye_hifi.fastplong.html",
+ "test_hifi_flye/reads/fastplong/hifi/test_hifi_flye_hifi.fastplong.json",
+ "test_hifi_flye/reads/fastplong/hifi/test_hifi_flye_hifi.fastplong.log",
+ "test_hifi_flye/reads/fastplong/ont",
+ "test_hifi_flye/reads/fastplong/ont/test_hifi_flye_ont.fastplong.fastq.gz",
+ "test_hifi_flye/reads/fastplong/ont/test_hifi_flye_ont.fastplong.html",
+ "test_hifi_flye/reads/fastplong/ont/test_hifi_flye_ont.fastplong.json",
+ "test_hifi_flye/reads/fastplong/ont/test_hifi_flye_ont.fastplong.log",
+ "test_hifi_hifiasm",
+ "test_hifi_hifiasm/assembly",
+ "test_hifi_hifiasm/assembly/hifiasm",
+ "test_hifi_hifiasm/assembly/hifiasm/fasta",
+ "test_hifi_hifiasm/assembly/hifiasm/fasta/test_hifi_hifiasm.bp.p_ctg.fa.gz",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.bp.hap1.p_ctg.gfa",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.bp.hap2.p_ctg.gfa",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.bp.p_ctg.gfa",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.bp.p_utg.gfa",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.bp.r_utg.gfa",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.ec.bin",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.ovlp.reverse.bin",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.ovlp.source.bin",
+ "test_hifi_hifiasm/assembly/hifiasm/test_hifi_hifiasm.stderr.log",
+ "test_hifi_hifiasm/assembly/test_hifi_hifiasm_assembly.gff3",
+ "test_hifi_hifiasm/assembly/test_hifi_hifiasm_assembly.unmapped.txt",
+ "test_hifi_hifiasm/reads",
+ "test_hifi_hifiasm/reads/fastplong",
+ "test_hifi_hifiasm/reads/fastplong/hifi",
+ "test_hifi_hifiasm/reads/fastplong/hifi/test_hifi_hifiasm_hifi.fastplong.fastq.gz",
+ "test_hifi_hifiasm/reads/fastplong/hifi/test_hifi_hifiasm_hifi.fastplong.html",
+ "test_hifi_hifiasm/reads/fastplong/hifi/test_hifi_hifiasm_hifi.fastplong.json",
+ "test_hifi_hifiasm/reads/fastplong/hifi/test_hifi_hifiasm_hifi.fastplong.log",
+ "test_hifi_hifiasm/reads/fastplong/ont",
+ "test_hifi_hifiasm/reads/fastplong/ont/test_hifi_hifiasm_ont.fastplong.fastq.gz",
+ "test_hifi_hifiasm/reads/fastplong/ont/test_hifi_hifiasm_ont.fastplong.html",
+ "test_hifi_hifiasm/reads/fastplong/ont/test_hifi_hifiasm_ont.fastplong.json",
+ "test_hifi_hifiasm/reads/fastplong/ont/test_hifi_hifiasm_ont.fastplong.log",
+ "test_hifiasm_flye",
+ "test_hifiasm_flye/assembly",
+ "test_hifiasm_flye/assembly/flye",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.assembly.fasta.gz",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.assembly_graph.gfa.gz",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.assembly_graph.gv.gz",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.assembly_info.txt",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.flye.log",
+ "test_hifiasm_flye/assembly/flye/test_hifiasm_flye.params.json",
+ "test_hifiasm_flye/assembly/hifiasm_ont",
+ "test_hifiasm_flye/assembly/hifiasm_ont/fasta",
+ "test_hifiasm_flye/assembly/hifiasm_ont/fasta/test_hifiasm_flye.bp.p_ctg.fa.gz",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.bp.hap1.p_ctg.gfa",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.bp.hap2.p_ctg.gfa",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.bp.p_ctg.gfa",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.bp.p_utg.gfa",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.bp.r_utg.gfa",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.ec.bin",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.ovlp.reverse.bin",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.ovlp.source.bin",
+ "test_hifiasm_flye/assembly/hifiasm_ont/test_hifiasm_flye.stderr.log",
+ "test_hifiasm_flye/assembly/ragtag",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.comps.fasta",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.ctg.agp",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.ctg.fasta",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.patch.agp",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.patch.err",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.patch.fasta",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.rename.agp",
+ "test_hifiasm_flye/assembly/ragtag/test_hifiasm_flye_assembly_patch.rename.fasta",
+ "test_hifiasm_flye/assembly/test_hifiasm_flye_assembly.gff3",
+ "test_hifiasm_flye/assembly/test_hifiasm_flye_assembly.unmapped.txt",
+ "test_hifiasm_flye/reads",
+ "test_hifiasm_flye/reads/fastplong",
+ "test_hifiasm_flye/reads/fastplong/hifi",
+ "test_hifiasm_flye/reads/fastplong/hifi/test_hifiasm_flye_hifi.fastplong.fastq.gz",
+ "test_hifiasm_flye/reads/fastplong/hifi/test_hifiasm_flye_hifi.fastplong.html",
+ "test_hifiasm_flye/reads/fastplong/hifi/test_hifiasm_flye_hifi.fastplong.json",
+ "test_hifiasm_flye/reads/fastplong/hifi/test_hifiasm_flye_hifi.fastplong.log",
+ "test_hifiasm_flye/reads/fastplong/ont",
+ "test_hifiasm_flye/reads/fastplong/ont/test_hifiasm_flye_ont.fastplong.fastq.gz",
+ "test_hifiasm_flye/reads/fastplong/ont/test_hifiasm_flye_ont.fastplong.html",
+ "test_hifiasm_flye/reads/fastplong/ont/test_hifiasm_flye_ont.fastplong.json",
+ "test_hifiasm_flye/reads/fastplong/ont/test_hifiasm_flye_ont.fastplong.log",
+ "test_hifiasm_ul",
+ "test_hifiasm_ul/assembly",
+ "test_hifiasm_ul/assembly/hifiasm",
+ "test_hifiasm_ul/assembly/hifiasm/fasta",
+ "test_hifiasm_ul/assembly/hifiasm/fasta/test_hifiasm_ul.bp.p_ctg.fa.gz",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.bp.hap1.p_ctg.gfa",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.bp.hap2.p_ctg.gfa",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.bp.p_ctg.gfa",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.bp.p_utg.gfa",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.bp.r_utg.gfa",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.ec.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.ovlp.reverse.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.ovlp.source.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.re.uidx.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.re.uidx.ucr.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.re.ul.msk.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.re.ul.ovlp.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.stderr.log",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.uidx.bin",
+ "test_hifiasm_ul/assembly/hifiasm/test_hifiasm_ul.ul.ovlp.bin",
+ "test_hifiasm_ul/assembly/test_hifiasm_ul_assembly.gff3",
+ "test_hifiasm_ul/assembly/test_hifiasm_ul_assembly.unmapped.txt",
+ "test_hifiasm_ul/reads",
+ "test_hifiasm_ul/reads/fastplong",
+ "test_hifiasm_ul/reads/fastplong/hifi",
+ "test_hifiasm_ul/reads/fastplong/hifi/test_hifiasm_ul_hifi.fastplong.fastq.gz",
+ "test_hifiasm_ul/reads/fastplong/hifi/test_hifiasm_ul_hifi.fastplong.html",
+ "test_hifiasm_ul/reads/fastplong/hifi/test_hifiasm_ul_hifi.fastplong.json",
+ "test_hifiasm_ul/reads/fastplong/hifi/test_hifiasm_ul_hifi.fastplong.log",
+ "test_hifiasm_ul/reads/fastplong/ont",
+ "test_hifiasm_ul/reads/fastplong/ont/test_hifiasm_ul_ont.fastplong.fastq.gz",
+ "test_hifiasm_ul/reads/fastplong/ont/test_hifiasm_ul_ont.fastplong.html",
+ "test_hifiasm_ul/reads/fastplong/ont/test_hifiasm_ul_ont.fastplong.json",
+ "test_hifiasm_ul/reads/fastplong/ont/test_hifiasm_ul_ont.fastplong.log",
+ "test_hifiasm_ul/scaffold",
+ "test_hifiasm_ul/scaffold/longstitch",
+ "test_hifiasm_ul/scaffold/longstitch/test_hifiasm_ul_longstitch.gff3",
+ "test_hifiasm_ul/scaffold/longstitch/test_hifiasm_ul_longstitch.tigmint-ntLink-arks.fa",
+ "test_hifiasm_ul/scaffold/longstitch/test_hifiasm_ul_longstitch.tigmint-ntLink.fa",
+ "test_hifiasm_ul/scaffold/longstitch/test_hifiasm_ul_longstitch.unmapped.txt",
+ "test_ont_flye",
+ "test_ont_flye/assembly",
+ "test_ont_flye/assembly/flye",
+ "test_ont_flye/assembly/flye/test_ont_flye.assembly.fasta.gz",
+ "test_ont_flye/assembly/flye/test_ont_flye.assembly_graph.gfa.gz",
+ "test_ont_flye/assembly/flye/test_ont_flye.assembly_graph.gv.gz",
+ "test_ont_flye/assembly/flye/test_ont_flye.assembly_info.txt",
+ "test_ont_flye/assembly/flye/test_ont_flye.flye.log",
+ "test_ont_flye/assembly/flye/test_ont_flye.params.json",
+ "test_ont_flye/assembly/test_ont_flye_assembly.gff3",
+ "test_ont_flye/assembly/test_ont_flye_assembly.unmapped.txt",
+ "test_ont_flye/reads",
+ "test_ont_flye/reads/fastplong",
+ "test_ont_flye/reads/fastplong/hifi",
+ "test_ont_flye/reads/fastplong/hifi/test_ont_flye_hifi.fastplong.fastq.gz",
+ "test_ont_flye/reads/fastplong/hifi/test_ont_flye_hifi.fastplong.html",
+ "test_ont_flye/reads/fastplong/hifi/test_ont_flye_hifi.fastplong.json",
+ "test_ont_flye/reads/fastplong/hifi/test_ont_flye_hifi.fastplong.log",
+ "test_ont_flye/reads/fastplong/ont",
+ "test_ont_flye/reads/fastplong/ont/test_ont_flye_ont.fastplong.fastq.gz",
+ "test_ont_flye/reads/fastplong/ont/test_ont_flye_ont.fastplong.html",
+ "test_ont_flye/reads/fastplong/ont/test_ont_flye_ont.fastplong.json",
+ "test_ont_flye/reads/fastplong/ont/test_ont_flye_ont.fastplong.log",
+ "test_ont_hifiasm",
+ "test_ont_hifiasm/assembly",
+ "test_ont_hifiasm/assembly/hifiasm_ont",
+ "test_ont_hifiasm/assembly/hifiasm_ont/fasta",
+ "test_ont_hifiasm/assembly/hifiasm_ont/fasta/test_ont_hifiasm.bp.p_ctg.fa.gz",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.bp.hap1.p_ctg.gfa",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.bp.hap2.p_ctg.gfa",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.bp.p_ctg.gfa",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.bp.p_utg.gfa",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.bp.r_utg.gfa",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.ec.bin",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.ovlp.reverse.bin",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.ovlp.source.bin",
+ "test_ont_hifiasm/assembly/hifiasm_ont/test_ont_hifiasm.stderr.log",
+ "test_ont_hifiasm/assembly/test_ont_hifiasm_assembly.gff3",
+ "test_ont_hifiasm/assembly/test_ont_hifiasm_assembly.unmapped.txt",
+ "test_ont_hifiasm/reads",
+ "test_ont_hifiasm/reads/fastplong",
+ "test_ont_hifiasm/reads/fastplong/hifi",
+ "test_ont_hifiasm/reads/fastplong/hifi/test_ont_hifiasm_hifi.fastplong.fastq.gz",
+ "test_ont_hifiasm/reads/fastplong/hifi/test_ont_hifiasm_hifi.fastplong.html",
+ "test_ont_hifiasm/reads/fastplong/hifi/test_ont_hifiasm_hifi.fastplong.json",
+ "test_ont_hifiasm/reads/fastplong/hifi/test_ont_hifiasm_hifi.fastplong.log",
+ "test_ont_hifiasm/reads/fastplong/ont",
+ "test_ont_hifiasm/reads/fastplong/ont/test_ont_hifiasm_ont.fastplong.fastq.gz",
+ "test_ont_hifiasm/reads/fastplong/ont/test_ont_hifiasm_ont.fastplong.html",
+ "test_ont_hifiasm/reads/fastplong/ont/test_ont_hifiasm_ont.fastplong.json",
+ "test_ont_hifiasm/reads/fastplong/ont/test_ont_hifiasm_ont.fastplong.log",
+ "test_ont_hifiasm/scaffold",
+ "test_ont_hifiasm/scaffold/ragtag",
+ "test_ont_hifiasm/scaffold/ragtag/test_ont_hifiasm_ragtag.agp",
+ "test_ont_hifiasm/scaffold/ragtag/test_ont_hifiasm_ragtag.fasta",
+ "test_ont_hifiasm/scaffold/ragtag/test_ont_hifiasm_ragtag.stats"
],
[
- "Col-0_2MB_report.json:md5,25d7ae5780b2f565cb46df7c9e09388a",
- "Col-0_2MB_stats.json:md5,d41d8cd98f00b204e9800998ecf8427e",
- "Col-0_2MB.params.json:md5,afa91c041bce5e190f4a699d11b69db6",
- "Col-0_2MB.bp.hap1.p_ctg.gfa:md5,46ee70869884ad585165bd48081414e9",
- "Col-0_2MB.bp.hap2.p_ctg.gfa:md5,7792865547989d6d284f640425c4e36c",
- "Col-0_2MB.bp.p_ctg.gfa:md5,8fe65466d76815ffe1663ff6d8f2e8d1",
- "Col-0_2MB.bp.p_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
- "Col-0_2MB.bp.r_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
- "Col-0_2MB.bp.p_utg.fa.gz:md5,812a3a16dc68bb409deb69f0aef7e6a8",
- "Col-0_2MB_assembly_patch.patch.err:md5,d41d8cd98f00b204e9800998ecf8427e"
+ "test_flye_hifiasm.params.json:md5,afa91c041bce5e190f4a699d11b69db6",
+ "test_flye_hifiasm.bp.hap1.p_ctg.gfa:md5,46ee70869884ad585165bd48081414e9",
+ "test_flye_hifiasm.bp.hap2.p_ctg.gfa:md5,7792865547989d6d284f640425c4e36c",
+ "test_flye_hifiasm.bp.p_ctg.gfa:md5,8fe65466d76815ffe1663ff6d8f2e8d1",
+ "test_flye_hifiasm.bp.p_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_flye_hifiasm.bp.r_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_flye_hifiasm_assembly_patch.patch.err:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_flye_hifiasm_assembly_patch.rename.fasta:md5,0515edc4c23258ef17d6ba085a6e4d31",
+ "test_flye_hifiasm_assembly.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_flye_hifiasm_hifi.fastplong.json:md5,0e20fedb8dfe0646232060da502883ee",
+ "test_flye_hifiasm_ont.fastplong.json:md5,826cc5a321dd130a2f2c53cdb1a345b2",
+ "test_hifi_flye_hifi.fastplong.json:md5,daad59b32b84b79c29c274ed20f03cce",
+ "test_hifi_flye_ont.fastplong.json:md5,198eb762846548340557f5f861f10c11",
+ "test_hifi_hifiasm.bp.hap1.p_ctg.gfa:md5,46ee70869884ad585165bd48081414e9",
+ "test_hifi_hifiasm.bp.hap2.p_ctg.gfa:md5,7792865547989d6d284f640425c4e36c",
+ "test_hifi_hifiasm.bp.p_ctg.gfa:md5,8fe65466d76815ffe1663ff6d8f2e8d1",
+ "test_hifi_hifiasm.bp.p_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_hifi_hifiasm.bp.r_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_hifi_hifiasm_assembly.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_hifi_hifiasm_hifi.fastplong.json:md5,e58f896e9b70344ae4e607324c2c6742",
+ "test_hifi_hifiasm_ont.fastplong.json:md5,eedbb98c4d3870f38320d75b21c86604",
+ "test_hifiasm_flye.params.json:md5,54b576cb6d4d27656878a7fd3657bde9",
+ "test_hifiasm_flye.bp.hap1.p_ctg.gfa:md5,c9a084903ea872a7ac28f3bbd5eee8f3",
+ "test_hifiasm_flye.bp.hap2.p_ctg.gfa:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_hifiasm_flye.bp.p_ctg.gfa:md5,d78f7a647429b254d9d46aab4d1306a0",
+ "test_hifiasm_flye.bp.p_utg.gfa:md5,e2b6621386edda1636dfb84ddd676ea8",
+ "test_hifiasm_flye.bp.r_utg.gfa:md5,e2b6621386edda1636dfb84ddd676ea8",
+ "test_hifiasm_flye_assembly_patch.comps.fasta:md5,6cfb8070823979baece63889e324e246",
+ "test_hifiasm_flye_assembly_patch.ctg.fasta:md5,6ff15d809eaa0ecf6381400cdd7f0770",
+ "test_hifiasm_flye_assembly_patch.patch.err:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_hifiasm_flye_assembly_patch.patch.fasta:md5,6ff15d809eaa0ecf6381400cdd7f0770",
+ "test_hifiasm_flye_assembly_patch.rename.fasta:md5,48208c6df370a225c6f54f378d7a8e39",
+ "test_hifiasm_flye_assembly.unmapped.txt:md5,e99c39c4afff7b433fb3973359dae6a4",
+ "test_hifiasm_flye_hifi.fastplong.json:md5,2671b946d2bf533341b86a9f2424e5c3",
+ "test_hifiasm_flye_ont.fastplong.json:md5,924d11a05764994135ff5de294052a02",
+ "test_hifiasm_ul.bp.hap1.p_ctg.gfa:md5,46ee70869884ad585165bd48081414e9",
+ "test_hifiasm_ul.bp.hap2.p_ctg.gfa:md5,7792865547989d6d284f640425c4e36c",
+ "test_hifiasm_ul.bp.p_ctg.gfa:md5,8fe65466d76815ffe1663ff6d8f2e8d1",
+ "test_hifiasm_ul.bp.p_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_hifiasm_ul.bp.r_utg.gfa:md5,ba2c77ebdb2ad3e6060f5574e890c6eb",
+ "test_hifiasm_ul_assembly.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_hifiasm_ul_hifi.fastplong.json:md5,f52a2b6d9aa29fbe5749684ee479de90",
+ "test_hifiasm_ul_ont.fastplong.json:md5,86da6d58ac4630bfeae3ee08014ecb0b",
+ "test_hifiasm_ul_longstitch.tigmint-ntLink.fa:md5,301136e56bd854239f31e96e32bc49d4",
+ "test_hifiasm_ul_longstitch.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_ont_flye.params.json:md5,afa91c041bce5e190f4a699d11b69db6",
+ "test_ont_flye_assembly.unmapped.txt:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_ont_flye_hifi.fastplong.json:md5,9205a4cf65cce249429badc208348349",
+ "test_ont_flye_ont.fastplong.json:md5,e418b2481ade21bc45e77d1437bad913",
+ "test_ont_hifiasm.bp.hap1.p_ctg.gfa:md5,c9a084903ea872a7ac28f3bbd5eee8f3",
+ "test_ont_hifiasm.bp.hap2.p_ctg.gfa:md5,d41d8cd98f00b204e9800998ecf8427e",
+ "test_ont_hifiasm.bp.p_ctg.gfa:md5,d78f7a647429b254d9d46aab4d1306a0",
+ "test_ont_hifiasm.bp.p_utg.gfa:md5,e2b6621386edda1636dfb84ddd676ea8",
+ "test_ont_hifiasm.bp.r_utg.gfa:md5,e2b6621386edda1636dfb84ddd676ea8",
+ "test_ont_hifiasm_assembly.unmapped.txt:md5,e99c39c4afff7b433fb3973359dae6a4",
+ "test_ont_hifiasm_hifi.fastplong.json:md5,91878df7edc2b07a885c103f260fc70e",
+ "test_ont_hifiasm_ont.fastplong.json:md5,e97714274268b5a30be4d9851f2b61b3",
+ "test_ont_hifiasm_ragtag.fasta:md5,51f2975257b49657716d2ca7cc6d5fe2",
+ "test_ont_hifiasm_ragtag.stats:md5,466273b499384b2c781c83dc583b8c99"
]
],
+ "timestamp": "2026-02-19T10:11:41.761287489",
"meta": {
- "nf-test": "0.9.2",
- "nextflow": "24.10.5"
- },
- "timestamp": "2025-07-02T11:25:42.487154678"
+ "nf-test": "0.9.4",
+ "nextflow": "25.10.0"
+ }
}
}
\ No newline at end of file
diff --git a/workflows/genomeassembler.nf b/workflows/genomeassembler.nf
index 48b2d6db..9301c07f 100644
--- a/workflows/genomeassembler.nf
+++ b/workflows/genomeassembler.nf
@@ -3,153 +3,158 @@
IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
*/
-include { paramsSummaryMap } from 'plugin/nf-schema'
-include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline'
-include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline'
-include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_genomeassembler_pipeline'
-// Read preparation
-include { PREPARE_ONT } from '../subworkflows/local/prepare_ont/main'
-include { PREPARE_HIFI } from '../subworkflows/local/prepare_hifi/main'
-include { PREPARE_SHORTREADS } from '../subworkflows/local/prepare_shortreads/main'
+include { paramsSummaryMap } from 'plugin/nf-schema'
+include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline'
+include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline'
+include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_genomeassembler_pipeline'
-// Read checks
-include { ONT } from '../subworkflows/local/ont/main'
-include { HIFI } from '../subworkflows/local/hifi/main'
+// Read preparation
+include { PREPARE } from '../subworkflows/local/prepare/main'
// Assembly
-include { ASSEMBLE } from '../subworkflows/local/assemble/main'
+include { ASSEMBLE } from '../subworkflows/local/assemble/main'
// Polishing
-include { POLISH } from '../subworkflows/local/polishing/main'
-
+include { POLISH } from '../subworkflows/local/polishing/main'
// Scaffolding
-include { SCAFFOLD } from '../subworkflows/local/scaffolding/main'
+include { SCAFFOLD } from '../subworkflows/local/scaffold/main'
+
// reporting
-include { REPORT } from '../modules/local/report/main'
+include { REPORT } from '../modules/local/report/main'
/*
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
- RUN MAIN WORKFLOW
+ MAIN WORKFLOW
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
*/
workflow GENOMEASSEMBLER {
take:
ch_input
- ch_refs
main:
// Initialize empty channels
- Channel.empty().set { ch_ref_bam }
- Channel.empty().set { ch_polished_genome }
- Channel.empty().set { ch_ont_reads }
- Channel.empty().set { ch_hifi_reads }
- Channel.empty().set { ch_shortreads }
- Channel.empty().set { meryl_kmers }
- Channel.empty().set { genome_size }
- Channel.empty().set { ch_versions }
+ ch_input.set { ch_main }
+
+ /*
+ This pipeline uses a "meta-stuffing" appraoch. All information
+ about a sample is always stored in a map stored in [0]/"meta".
+ Values are extracted from the map to create input channels.
+ The correspoding key is created or updated from outputs.
+ This largely eliminates the need for joins.
+
+ The initial keys are defined in
+ ./subworkflows/local/utils_nfcore_genomeassembler/main.nf
+ */
+ channel.empty().set { meryl_kmers }
+
// Initialize channels for QC report collection
- Channel
+ channel
.of([])
.tap { quast_files }
- .tap { nanoq_files }
+ .tap { fastplong_jsons }
.tap { genomescope_files }
.map { it -> ["dummy", it] }
.tap { busco_files }
.map { it -> [it[0], it[1], it[1], it[1], it[1]] }
.tap { merqury_files }
- /*
- =============
- Some checks
- =============
- */
- if (!params.ont && !params.hifi) {
- error('At least one of params.ont, params.hifi needs to be true.')
- }
+
/*
=============
Prepare reads
=============
*/
- /*
- Short reads
- */
- if (params.short_reads) {
- PREPARE_SHORTREADS(ch_input)
- PREPARE_SHORTREADS.out.shortreads.set { ch_shortreads }
- PREPARE_SHORTREADS.out.meryl_kmers.set { meryl_kmers }
- ch_versions = ch_versions.mix(PREPARE_SHORTREADS.out.versions)
- }
+ PREPARE(ch_main)
- ch_input.map { it -> [it.meta, params.genome_size] }
- .set { genome_size }
-
- /*
- ONT reads
- */
- if (params.ont) {
- ONT(ch_input, genome_size)
- ONT.out.genome_size.set { genome_size }
- ONT.out.ont_reads.set { ch_ont_reads }
-
- ONT.out.nanoq_report
- .concat(
- ONT.out.nanoq_stats
- )
- .collect { it -> it[1] }
- .set { nanoq_files }
- ONT.out.genomescope_summary
- .concat(
- ONT.out.genomescope_plot
- )
- .unique()
- .collect { it -> it[1] }
- .set { genomescope_files }
-
- ch_versions = ch_versions.mix(ONT.out.versions)
- }
+ PREPARE.out.ch_main.set { ch_main_prepared }
+ PREPARE.out.meryl_kmers.set { meryl_kmers }
/*
- HIFI reads
+ Assembly
*/
- if (params.hifi) {
- HIFI(ch_input)
- HIFI.out.hifi_reads.set { ch_hifi_reads }
+ // This pipeline is named genomeassembler, so everything goes into assemble
+ // even it might not actually be assembled.
- ch_versions = ch_versions.mix(HIFI.out.versions)
- }
+ ASSEMBLE(ch_main_prepared, meryl_kmers)
- /*
- Assembly
- */
+ ASSEMBLE.out.ch_main.set { ch_main_assembled }
- ASSEMBLE(ch_ont_reads, ch_hifi_reads, ch_input, genome_size, meryl_kmers)
- ASSEMBLE.out.assembly.set { ch_polished_genome }
- ASSEMBLE.out.ref_bam.set { ch_ref_bam }
- ASSEMBLE.out.longreads.set { ch_longreads }
- ch_versions = ch_versions.mix(ASSEMBLE.out.versions)
/*
Polishing
*/
+ ch_main_assembled
+ .branch {
+ it ->
+ def polishers = ["pilon", "medaka", "medaka+pilon", "dorado", "dorado+pilon"]
+ polish: polishers.contains(it.meta.polish)
+ no_polish: true
+ }
+ .set { ch_main_assembled_branched }
- POLISH(ch_input, ch_ont_reads, ch_longreads, ch_shortreads, ch_polished_genome, ch_ref_bam, meryl_kmers)
- POLISH.out.ch_polished_genome.set { ch_polished_genome }
+ POLISH(ch_main_assembled_branched.polish, meryl_kmers)
- ch_versions = ch_versions.mix(POLISH.out.versions)
+ ch_main_assembled_branched.no_polish
+ .mix(POLISH.out.ch_main)
+ .set { ch_main_polished }
+ // Update scaffold for meta map
+ ch_main_polished
+ .branch { it ->
+ scaffold: it.meta.scaffold_links || it.meta.scaffold_longstitch || it.meta.scaffold_ragtag
+ no_scaffold: !it.meta.scaffold_links && !it.meta.scaffold_longstitch && !it.meta.scaffold_ragtag
+ }
+ .set {
+ ch_main_polished_branched
+ }
/*
Scaffolding
*/
- SCAFFOLD(ch_input, ch_longreads, ch_polished_genome, ch_refs, ch_ref_bam, meryl_kmers, genome_size)
+ SCAFFOLD(ch_main_polished_branched.scaffold, meryl_kmers)
+
+ // Recreate ch_main, even though it is not used since there are no later steps.
- ch_versions = ch_versions.mix(SCAFFOLD.out.versions)
+ ch_main_polished_branched
+ .no_scaffold
+ .mix(SCAFFOLD.out.ch_main)
+ .set { ch_main_scaffolded }
+ PREPARE.out.fastplong_json_reports
+ .map { it -> it[1] }
+ .unique()
+ .collect()
+ .set { fastplong_jsons }
+
+ PREPARE.out.genomescope_summary
+ .concat(
+ PREPARE.out.genomescope_plot
+ )
+ .unique()
+ .collect { it -> it[1] }
+ .set { genomescope_files }
+
+ def topic_versions = channel.topic("versions")
+ .distinct()
+ .branch { entry ->
+ versions_file: entry instanceof Path
+ versions_tuple: true
+ }
+
+ def topic_versions_string = topic_versions.versions_tuple
+ .map { process, tool, version ->
+ [ process[process.lastIndexOf(':')+1..-1], " ${tool}: ${version}" ]
+ }
+ .groupTuple(by:0)
+ .map { process, tool_versions ->
+ tool_versions.unique().sort()
+ "${process}:\n${tool_versions.join('\n')}"
+ }
+ ch_collated_versions = topic_versions_string
/*
Report
*/
- softwareVersionsToYAML(ch_versions)
+ ch_collated_versions
.collectFile(
storeDir: "${params.outdir}/pipeline_info",
name: 'nf_core_' + 'pipeline_software_' + 'versions.yml',
@@ -158,10 +163,12 @@ workflow GENOMEASSEMBLER {
)
quast_files
- .concat(
- ASSEMBLE.out.assembly_quast_reports.concat(
+ .mix(
+ ASSEMBLE.out.assembly_quast_reports
+ .mix(
POLISH.out.polish_quast_reports
- ).concat(
+ )
+ .mix(
SCAFFOLD.out.scaffold_quast_reports
)
)
@@ -170,10 +177,12 @@ workflow GENOMEASSEMBLER {
.set { quast_files }
busco_files
- .concat(
- ASSEMBLE.out.assembly_busco_reports.concat(
+ .mix(
+ ASSEMBLE.out.assembly_busco_reports
+ .mix(
POLISH.out.polish_busco_reports
- ).concat(
+ )
+ .mix(
SCAFFOLD.out.scaffold_busco_reports
)
)
@@ -182,10 +191,12 @@ workflow GENOMEASSEMBLER {
.set { busco_files }
merqury_files
- .concat(
- ASSEMBLE.out.assembly_merqury_reports.concat(
+ .mix(
+ ASSEMBLE.out.assembly_merqury_reports
+ .mix(
POLISH.out.polish_merqury_reports
- ).concat(
+ )
+ .mix(
SCAFFOLD.out.scaffold_merqury_reports
)
)
@@ -195,54 +206,34 @@ workflow GENOMEASSEMBLER {
.collect()
.set { merqury_files }
- Channel
+ channel
.fromPath("${projectDir}/assets/report/*")
.collect()
.set { report_files }
// Report files
- Channel
+ channel
.fromPath("${projectDir}/assets/report/functions/*")
.collect()
.set { report_functions }
-
- if(!params.merqury) {
- merqury_files = Channel.of([])
- }
-
- REPORT(report_files, report_functions, nanoq_files, genomescope_files, quast_files, busco_files, merqury_files, Channel.fromPath("${params.outdir}/pipeline_info/nf_core_pipeline_software_versions.yml"))
-
- //
- // Collate and save software versions
- //
- def topic_versions = Channel.topic("versions")
- .distinct()
- .branch { entry ->
- versions_file: entry instanceof Path
- versions_tuple: true
- }
-
- def topic_versions_string = topic_versions.versions_tuple
- .map { process, tool, version ->
- [ process[process.lastIndexOf(':')+1..-1], " ${tool}: ${version}" ]
- }
- .groupTuple(by:0)
- .map { process, tool_versions ->
- tool_versions.unique().sort()
- "${process}:\n${tool_versions.join('\n')}"
- }
-
- softwareVersionsToYAML(ch_versions.mix(topic_versions.versions_file))
- .mix(topic_versions_string)
- .collectFile(
- storeDir: "${params.outdir}/pipeline_info",
- name: 'nf_core_' + 'genomeassembler_software_' + 'versions.yml',
- sort: true,
- newLine: true
- )
+ channel
+ .fromPath("${projectDir}/assets/report/scripts/*")
+ .collect()
+ .set { report_scripts }
+
+ REPORT( report_files,
+ report_functions,
+ report_scripts,
+ fastplong_jsons,
+ genomescope_files,
+ quast_files,
+ busco_files,
+ merqury_files,
+ channel.fromPath("${params.outdir}/pipeline_info/nf_core_pipeline_software_versions.yml"),
+ ch_main.map { it -> [sample: [id: it.meta.id, group: it.meta.group]] }.collect()
+ )
_report = REPORT.out.report_html.toList()
emit:
_report
- versions = ch_versions // channel: [ path(versions.yml) ]
}
+ ![\"nf-core/genomeassembler\"](\"docs/images/nf-core-genomeassembler_logo_dark.png\"){kind=logo}
\n ![\"nf-core/genomeassembler\"](\"docs/images/genomeassembler.dark.png\")
\n