Skip to content

NEWS.md

Latest commit

 

History

History
152 lines (98 loc) · 5.65 KB

NEWS.md

File metadata and controls

152 lines (98 loc) · 5.65 KB

stringmagic 1.2.0

Compatibility with old R versions

  • stringmagic is now fully compatible with R v3.5.0 (at least)

Bugs

  • fix major bug in the if-else operator (&) leading to opposite operations

  • in string_vec, fix bug leading to the removal of empty strings

  • in string_vec, fix bugs with the arguments .sep and .collapse

  • in C code: use STRING_PTR_RO instead of STRING_PTR to comply with new CRAN policy

New operators

  • string_magic: new operator table to flexibly attach elements with their frequencies:
dna = string_split("atagggagctacctgcgcgtcgcccaaaagcaggg", "")
cat_magic("Letters in the DNA seq. {''c, Q ? dna}: ",
          # by default: inverse frequency sorting
          "  -      default: {table, enum ? dna}",
          "  - value sorted: {table.sort, enum ? dna}",
          # argument in single quotes to customize the display, it's a 
          #   `string_magic` interpolation
          "  -       shares: {'{x} [{round(s * 100)}%]' table, enum ? dna}",
          # `fsort` sorts by **increasing** frequency
          "  - freq. sorted: {'{q ? x}' table.fsort, enum ? dna}",
          .sep = "\n")
#> Letters in the DNA seq. "atagggagctacctgcgcgtcgcccaaaagcaggg": 
#>   -      default: g (12), c (10), a (9) and t (4)
#>   - value sorted: a (9), c (10), g (12) and t (4)
#>   -       shares: g [34%], c [29%], a [26%] and t [11%]
#>   - freq. sorted: 't', 'a', 'c' and 'g'
  • string_magic: new operators round and signif (wtih shorthands r0 to r6 and s0 to s6) to flexibly format numbers:
x = c(153, 207.256, 0.00254, 15231312.2)
# keeping one significant digit
cat_magic("v1: {s1, align ? x} ",
          # removing the comma for large numbers and preserving ints
          "v2: {s1.int.nocomma ? x}", .collapse = "\n")
#> v1: 153.0        v2: 153
#> v1: 207.2        v2: 207.2
#> v1: 0.002        v2: 0.002
#> v1: 15,231,312.2 v2: 15231312.2

string_magic("pi = {r3 ? pi}")
#> [1] "pi = 3.142"

New features

  • add the argument .data to string_magic(), used to evaluate variables in the interpolations

  • new functions get_interpolated_expr() and get_interpolated_vars(). This function recovers all the expressions to be interpolated in a call to string_magic() (oriented for developers).

  • new argument center.right in the function string_fill to resolve situations in which the characters are not perfectly centered

  • make cat_magic and message_magic more in line with their base R counterparts (they work properly with vectors now)

User visible change: Functions renaming

  • the functions st_ops, st_is, st_any, st_all have been renamed into stops, stis, stany, stall to align with the convention of all other aliases. Although the names aren't great, at least they are consistent.

Minor changes

  • the new operator swidth (screen width) replaces the operator width. The operator width becomes an alias for fill.

  • the default screen width for message_magic becomes the minimum between 100 characters and 90% of the current screen size (actually the console size).

  • rework the argument .width in message_magic and cat_magic: now the special variable .sw can only be used in a one-sided formula (non-standard evaluation is still supported for retro-compatibility)

  • improve error handling

  • add left option to operators when relevant. Thanks to @kylebutts, #3

  • in string_vec, change the default of argument .protect.vars to FALSE, which is much more aligned to common sense

  • in string_magic's argument .post: removal of argument catching, which could lead, occasionnally, to bugs very hard to understand

  • in string_vec: add the arguments .check and .help.

stringmagic 1.1.2

Hot fix

  • make stringmagic compatible with R in [4.1.0; 4.1.2].

New features

  • add argument .trigger to cat/message_magic_alias

stringmagic 1.1.1

Hot fix

  • make stringmagic compatible with R < 4.1.0 by removing calls to ...names().

stringmagic 1.1.0

New functions

  • add string_extract to extract patterns

  • add string_split to split character strings

Improvements

  • string_ops now uses ... to pass operations. This is backward compatible.

  • string_clean: now the magic flag also expands the replacements:

x = "Hi Mary, how's John doing?"
from = "John"
to = "Kate"
string_clean(x, "m/{from} => {to}")
#> [1] "Hi Mary, how's Kate doing?"

  • string_magic: add the comma flag to the enum operation. In that case, the enumeration ends with ", " instead of ", and ".

  • string_magic: the if-else operation & now keeps memory of variables accessed within data sets:

data = list(x = c(15, 25, 550), y = rnorm(1000))
string_magic("The values are{& length(data$x) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are: 15, 25 and 550."
string_magic("The values are{& length(data$y) < 5 ; : {enum ? .} ;  too many}.")
# [1] "The values are too many."

  • string_magic: new operation deparse (alias: dp) to deparse an object and keep only the first characters of the deparsed string.

  • improve error messages.

Aliases

  • new battery of short aliases: sma for string_magic, catma for catmagic, mema for message_magic, etc.. (st_ops, st_is, st_any, st_all, stextract, stwhich, stget, stclean, stvec, streplace, stsplit -- short names with vowels after st have an underscore.)

stringmagic 1.0.0

First public release. The syntax should be stable.

This package is a spinoff from fixest's formula syntax interpolation.

Many thanks to Achim Zeileis, Vincent Arel-Bundock and Kyle Butts who provided insightful comments during the development.