mapping: loses contigs?

[sjanssen2]

I figure the file /vol/jlab/tlin/all_project/nf_results/assembler_benchmark_pipeline/marbel_benchmarking_sets_all/assembler/oak_mt_merged/rnaspades_contigs.fa holds all contigs the assembler "rnaspades" produces.

With the file /vol/jlab/tlin/all_project/nf_results/refbasedassemblereval/oak/minimap2/rnaspades_mapping.tsv, you map these contigs to the expected reference meta transcriptome of the oak environment?!

I wonder why the following two "contigs", are not contained in the rnaspades_mapping.tsv:

>NODE_39043_length_239_cov_69.022472_g38529_i0
TAAAAATCATCGCGAGAGAATTTTTTTCCAGTCGGTATAATATATTTCTTATCTATATAT
ATACAATATTTTATATCAAAAAGTAAAATAGTATAGCCATAGATTATACCATCTTCTTCG
CTTATACCTAATACCACTCCTTTTTTTCCTTTAATAGTCTCACCATTTTCTAACAAATCA
TTAGGGCAAGAATCTTTTATAATAACTTCAGAGTAGAAATCTAATTTTAAATTAGTCAT

>NODE_42406_length_173_cov_2.026786_g41892_i0
CTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCG
CCGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGACGCTGTCG
CTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTCGCTGTC

[tensulin]

Probably because minimap2 cannot map them against the reference, I will try it out manually and report the result

[tensulin]

minimap2 seems to be unable to map them against the block fasta if I use --paf-no-hit they appear in the result but without target genomic coordinates

Test result:

tlin@rs620-bcf-1-4:/vol/jlab/tlin/no_backup/nextflow_workdir/ba/79b72f193d71d03eb5e59e4b3019ed$ cat test_res.tsv 
NODE_39043_length_239_cov_69.022472_g38529_i0	239	0	0	*	*	0	0	0	0	0	0	rl:i:0
NODE_42406_length_173_cov_2.026786_g41892_i0	173	0	0	*	*	0	0	0	0	0	0	rl:i:159

Working directory: /vol/jlab/tlin/no_backup/nextflow_workdir/ba/79b72f193d71d03eb5e59e4b3019ed

[tensulin]

In the workflow the next step is to see whether the matches are good enough for our quality filter and then filter out the ones that pass the filter, which means its not a problem that they don't appear in the minimap2 output, because they are still analysed later on.