test: port remap_divref tests to pytest; fix coordinate translation

Updates remap_divref.py to match upstream v1.1: sign-dependent
coordinate check in _translate_coordinate_to_ref and gap-stripping
in padded_len_adj. Updates test expectations to reflect that
population_frequencies contains all variant frequencies (not sliced
to in-range variants). Adds test_remap_divref.py with six tests
covering coordinate translation, gap handling, and haplotype
remapping; all pass.

Co-Authored-By: Claude Sonnet 4.6 <noreply@anthropic.com>

Author: ameynert

divref/divref/tools/remap_divref.py

@@ -202,7 +202,9 @@ def _translate_coordinate_to_ref(
         Reference genome position (1-based locus coordinate).
     """
     first_variant_start = variant_intervals[0][0]
-    if coord < first_variant_start:
+    if (coord < first_variant_start and sign == -1) or (
+        coord - 1 < first_variant_start and sign == 1
+    ):
         return vs[0].position - (first_variant_start - coord)
 
     last_smaller_variant = 0
@@ -317,7 +319,7 @@ def remap_divref(
             padded_target: str = df_row["padded_target"]
             target: str = df_row["unpadded_target_sequence"]
 
-            padded_len_adj = len(padded_target) - len(target)
+            padded_len_adj = len(padded_target.replace("-", "")) - len(target)
             if strand == "+":
                 end += padded_len_adj
             else:

divref/tests/tools/test_remap_divref.py

@@ -0,0 +1,158 @@
+"""Tests for Haplotype.reference_mapping coordinate translation in remap_divref."""
+
+from typing import Any
+
+from divref.tools.remap_divref import Haplotype
+from divref.tools.remap_divref import ReferenceMapping
+
+
+def create_haplotype(
+    sequence_id: str = "test_hap",
+    sequence: str = "ACGT",
+    sequence_length: int = 4,
+    n_variants: int = 3,
+    variants: str = "1:500:A:T,1:505:C:G,1:510:T:A",
+    gnomAD_AF_afr: str = "0.1,0.2,0.3",  # noqa: N803
+    gnomAD_AF_amr: str = "0.15,0.25,0.35",  # noqa: N803
+    gnomAD_AF_eas: str = "0.12,0.22,0.32",  # noqa: N803
+    gnomAD_AF_nfe: str = "0.11,0.21,0.31",  # noqa: N803
+    gnomAD_AF_sas: str = "0.13,0.23,0.33",  # noqa: N803
+    **kwargs: Any,
+) -> Haplotype:
+    """
+    Create a Haplotype instance with sensible defaults for testing.
+
+    Args:
+        sequence_id: Haplotype sequence identifier.
+        sequence: Haplotype sequence string.
+        sequence_length: Length of the sequence.
+        n_variants: Number of variants in the haplotype.
+        variants: Comma-separated variant strings (chrom:pos:ref:alt).
+        gnomAD_AF_afr: Comma-separated AFR allele frequencies per variant.
+        gnomAD_AF_amr: Comma-separated AMR allele frequencies per variant.
+        gnomAD_AF_eas: Comma-separated EAS allele frequencies per variant.
+        gnomAD_AF_nfe: Comma-separated NFE allele frequencies per variant.
+        gnomAD_AF_sas: Comma-separated SAS allele frequencies per variant.
+        **kwargs: Additional fields passed to Haplotype.
+
+    Returns:
+        A Haplotype instance for use in tests.
+    """
+    defaults: dict[str, Any] = {
+        "fraction_phased": 1.0,
+        "popmax_empirical_AF": 0.25,
+        "popmax_empirical_AC": 1000,
+        "estimated_gnomad_AF": 0.15,
+        "max_pop": "amr",
+        "source": "test_source",
+    }
+    defaults.update(kwargs)
+    return Haplotype(
+        sequence_id=sequence_id,
+        sequence=sequence,
+        sequence_length=sequence_length,
+        n_variants=n_variants,
+        variants=variants,
+        gnomAD_AF_afr=gnomAD_AF_afr,
+        gnomAD_AF_amr=gnomAD_AF_amr,
+        gnomAD_AF_eas=gnomAD_AF_eas,
+        gnomAD_AF_nfe=gnomAD_AF_nfe,
+        gnomAD_AF_sas=gnomAD_AF_sas,
+        **defaults,
+    )
+
+
+def test_basic_snp_variants_involved() -> None:
+    # With context_size=10, haplotype sequence pos 0 = reference pos 490.
+    # Variants at ref positions 500, 505, 510 map to haplotype positions 10, 15, 20.
+    # Query window [12, 17) overlaps only the second variant (pos 15..16).
+    haplotype = create_haplotype(sequence_id="hap1", variants="1:500:A:T,1:505:C:G,1:510:T:A")
+    rm: ReferenceMapping = haplotype.reference_mapping(12, 17, 10)
+
+    assert rm.first_variant_index == 1
+    assert rm.last_variant_index == 1
+    assert rm.population_frequencies == {
+        "afr": [0.1, 0.2, 0.3],
+        "amr": [0.15, 0.25, 0.35],
+        "eas": [0.12, 0.22, 0.32],
+        "nfe": [0.11, 0.21, 0.31],
+        "sas": [0.13, 0.23, 0.33],
+    }
+
+
+def test_deletion_shifts_coordinates() -> None:
+    # Second variant is a deletion (CC→G), which shifts subsequent haplotype positions.
+    # Query [14, 20) spans the deletion and the following SNP.
+    haplotype = create_haplotype(sequence_id="hap2", variants="1:500:A:T,1:505:CC:G,1:510:T:A")
+    rm = haplotype.reference_mapping(14, 20, 10)
+
+    assert rm.first_variant_index == 1
+    assert rm.last_variant_index == 2
+
+
+def test_insertion_shifts_coordinates() -> None:
+    # First variant is an insertion (T→TTT), which shifts subsequent haplotype positions.
+    # Query [15, 18) lands in the expanded haplotype space after the insertion.
+    haplotype = create_haplotype(sequence_id="hap3", variants="1:500:T:TTT,1:505:C:G,1:510:T:A")
+    rm = haplotype.reference_mapping(15, 18, 10)
+
+    assert rm.first_variant_index == 1
+    assert rm.last_variant_index == 1
+
+
+def test_no_variants_in_range() -> None:
+    # Query [0, 5) is entirely in the flanking context before any variant.
+    haplotype = create_haplotype(sequence_id="hap4", variants="1:500:A:T,1:510:C:G")
+    rm = haplotype.reference_mapping(0, 5, 10)
+
+    assert rm.first_variant_index is None
+    assert rm.last_variant_index is None
+
+
+def test_complex_multi_indel_mapping() -> None:
+    # Three variants: deletion, insertion, deletion. Query [9, 22) spans all three.
+    haplotype = create_haplotype(
+        sequence_id="hap5",
+        variants="1:500:AT:A,1:505:C:CTT,1:510:GGG:T",
+        gnomAD_AF_afr="0.05,0.15,0.25",
+        gnomAD_AF_amr="0.06,0.16,0.26",
+        gnomAD_AF_eas="0.07,0.17,0.27",
+        gnomAD_AF_nfe="0.04,0.14,0.24",
+        gnomAD_AF_sas="0.03,0.13,0.23",
+    )
+    rm = haplotype.reference_mapping(9, 22, 10)
+
+    assert rm.first_variant_index == 0
+    assert rm.last_variant_index == 2
+
+
+def test_large_insertion_with_null_frequencies() -> None:
+    # Single large insertion. null gnomAD frequencies should be parsed as 0.0.
+    # context_size=25, variant at ref pos 90349349.
+    # Query [22, 42) starts before the insertion (ref start = 90349349 - 3 = 90349346).
+    alt = "TATGCAAGTGTCATCAGATGAATTGATGACATTTTTGTCAAGTTTAAGCACTGAAAGAACAAACCTCTAAATC"
+    haplotype = create_haplotype(
+        sequence_id="hap6",
+        sequence="ACTACTATCTATATCATCTACTACTACTATCATCATCATCAT",
+        sequence_length=42,
+        n_variants=1,
+        variants=f"chr12:90349349:T:{alt}",
+        gnomAD_AF_afr="null",
+        gnomAD_AF_amr="null",
+        gnomAD_AF_eas="null",
+        gnomAD_AF_nfe="null",
+        gnomAD_AF_sas="null",
+    )
+    rm = haplotype.reference_mapping(22, 42, 25)
+
+    assert rm.first_variant_index == 0
+    assert rm.last_variant_index == 0
+    assert rm.start == 90349346
+    assert rm.end == 90349350
+    assert rm.population_frequencies == {
+        "afr": [0.0],
+        "amr": [0.0],
+        "eas": [0.0],
+        "nfe": [0.0],
+        "sas": [0.0],
+    }