py_idt

A python interface for creating IDT bulk oligo order forms in Excel.

You might find this module useful if you design DNA oligos in python and then order them from IDT.

Installation and Usage

Install the py_idt module:

Option 1) Using conda:

A minimal conda environment.yml is provided:

name: py_idt_env
channels:
  - defaults
dependencies:
  - pip=19.0.3
  - python=3.7.3
  - pip:
    - git+ssh://git@github.com/conorcamplisson/py_idt.git

To create and activate a conda environment using this file:

$ git clone git@github.com:conorcamplisson/py_idt.git
$ cd py_idt/
$ conda env create -f environment.yml
$ source activate py_idt_env

Option 2) Using pip:

$ pip install git+ssh://git@github.com/conorcamplisson/py_idt.git

Example usage (test_module.py):

from py_idt import IDTOrder

# configure output directory
IDTOrder.settings['output_dir'] = 'example_order'

def main():

    # create a new IDT oligonucleotide order
    order = IDTOrder()

    # add some oligos to this order
    order.add_oligo('Test_oligo_1', 'ACGTACGTACGTACGTACGT')
    order.add_oligo('Test_oligo_2', 'TGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA', scale='250nm', purification='PAGE')
    order.add_oligo('Test_oligo_3', '/5Phos/AAAAACCCCCGGGGGTTTTT', scale='100nm', purification='HPLC')

    # create Excel IDT bulk order form
    order.save()


if __name__ == '__main__':
    main()