main_spine_BsaI.py

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Wed Dec 29 16:59:28 2021

@author: weiqiyao
"""

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
The file is modified from main_spine and use different module to run DMS. The only difference is switch the TypeII enzyme from AarI to BsaI 

And the length of the oligo pools have been shrinked to 150 bp.

"""
#!/usr/bin/env python3
# -*- coding: utf-8 -*-


# RUN SPINE
# script for usage with command line

import argparse
from SPINE.SPINE_BsaI import align_genevariation, generate_DIS_fragments, print_all, post_qc, addgene, SPINEgene, generate_DMS_fragments, generate_S_INS_fragments, generate_S_DEL_fragments, generate_allmut_fragments

parser = argparse.ArgumentParser(description="SPINE Saturated Programmable INsertion Engineering")
parser.add_argument('-wDir', help='Working directory for fasta files and output folder')
parser.add_argument('-geneFile', required=True, help='Input all gene sequences including backbone in a fasta format. Place all in one fasta file. Name description can include start and end points (>gene1 start:1 end:2)')
parser.add_argument('-handle', default='AGCGGGAGACCGGGGTCTCTGAGC', help='Genetic handle for domain insertion. This is important for defining the linker. Currently uses BsaI (4 base overhang), but this can be swapped for SapI (3 base overhang).')
parser.add_argument('-matchSequences', action='store_const', const='match', default='nomatch', help='Find similar sequences between genes to avoid printing the same oligos multiple times. Default: No matching')
parser.add_argument('-oligoLen', required=True, type=int, help='Synthesized oligo length')
parser.add_argument('-fragmentLen', default=[], type=int, help='Maximum length of gene fragment')
parser.add_argument('-overlap', default=0, type=int, help='Enter number of bases to extend each fragment for overlap. This will help with insertions close to fragment boundary')
parser.add_argument('-mutationType',
                    default='DMS',
                    const='DMS',
                    nargs='?',
                    choices=['DIS', 'DMS','S_INS','S_DEL','allmut'],
                    help='Choose if you will run deep insertion scan, deep mutation scan, single amino acid insertion, deletion or bulk mutation')
parser.add_argument('-usage', default='human', help='Default is "human". Or select "ecoli"')
#parser.add_argument('-restrictionSeq', default=['GGTCTC', 'CGTCTC', 'GCTCTTC'])  # BsaI, BsmBI, SapI

args = parser.parse_args()

if args.wDir is None:
    if '/' in args.geneFile:
        args.wDir = args.geneFile.rsplit('/', 1)[0]+'/'
        args.geneFile = args.geneFile.rsplit('/', 1)[1]
    else:
        args.wDir = ''


if any([x not in ['A', 'C', 'G', 'T', 'a', 'c', 'g', 't','N'] for x in args.handle]):

    raise ValueError('Genetic handle contains non nucleic bases')

SPINEgene.handle = args.handle
SPINEgene.synth_len = args.oligoLen
if args.fragmentLen:
    SPINEgene.maxfrag = args.fragmentLen
else:
    SPINEgene.maxfrag = args.oligoLen - 62 - args.overlap # 62 allows for cutsites and barcodes (for AarI 2*(7+4))

#adjust primer primerBuffer
SPINEgene.primerBuffer += args.overlap

#SPINEgene.restrict_seq = args.restrictionSeq
if args.mutationType == 'DIS':
    SPINEgene.usage = None
else:
    if args.usage:
        SPINEgene.usage = args.usage

    

OLS = addgene(args.wDir+'/'+args.geneFile)

if args.matchSequences == 'match':
    align_genevariation(OLS)

if args.mutationType == 'DIS':
    generate_DIS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'DMS':
    generate_DMS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'S_DEL':
    generate_S_DEL_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'S_INS':
    generate_S_INS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'allmut':
    generate_allmut_fragments(OLS, args.overlap, args.wDir)


post_qc(OLS)
print_all(OLS, args.wDir)