main_spine.py

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""
Created on Wed Dec 29 16:59:28 2021

@author: weiqiyao
"""

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""

try to add single aa deletion and insertion function
"""
#!/usr/bin/env python3
# -*- coding: utf-8 -*-


# RUN SPINE
# script for usage with command line

import argparse
from SPINE.SPINE_v7 import align_genevariation, generate_DIS_fragments, print_all, post_qc, addgene, SPINEgene, generate_DMS_fragments, generate_S_INS_fragments, generate_S_DEL_fragments, generate_allmut_fragments, generate_allmut_noCys_fragments

parser = argparse.ArgumentParser(description="SPINE Saturated Programmable INsertion Engineering")
parser.add_argument('-wDir', help='Working directory for fasta files and output folder')
parser.add_argument('-geneFile', required=True, help='Input all gene sequences including backbone in a fasta format. Place all in one fasta file. Name description can include start and end points (>gene1 start:1 end:2)')
parser.add_argument('-handle', default='AGCGGGAGACCGGGGTCTCTGAGC', help='Genetic handle for domain insertion. This is important for defining the linker. Currently uses BsaI (4 base overhang), but this can be swapped for SapI (3 base overhang).')
parser.add_argument('-matchSequences', action='store_const', const='match', default='nomatch', help='Find similar sequences between genes to avoid printing the same oligos multiple times. Default: No matching')
parser.add_argument('-oligoLen', required=True, type=int, help='Synthesized oligo length')
parser.add_argument('-fragmentLen', default=[], type=int, help='Maximum length of gene fragment')
parser.add_argument('-overlap', default=0, type=int, help='Enter number of bases to extend each fragment for overlap. This will help with insertions close to fragment boundary')
parser.add_argument('-mutationType',
                    default='DMS',
                    const='DMS',
                    nargs='?',
                    choices=['DIS', 'DMS','S_INS','S_DEL','allmut','allmut_noCys'],
                    help='Choose if you will run deep insertion scan, deep mutation scan, single amino acid insertion, deletion or bulk mutation')
parser.add_argument('-usage', default='human', help='Default is "human". Or select "ecoli"')
#parser.add_argument('-restrictionSeq', default=['GGTCTC', 'CGTCTC', 'GCTCTTC'])  # BsaI, BsmBI, SapI

args = parser.parse_args()

if args.wDir is None:
    if '/' in args.geneFile:
        args.wDir = args.geneFile.rsplit('/', 1)[0]+'/'
        args.geneFile = args.geneFile.rsplit('/', 1)[1]
    else:
        args.wDir = ''

if any([x not in ['A', 'C', 'G', 'T', 'a', 'c', 'g', 't'] for x in args.handle]):
    raise ValueError('Genetic handle contains non nucleic bases')

SPINEgene.handle = args.handle
SPINEgene.synth_len = args.oligoLen
if args.fragmentLen:
    SPINEgene.maxfrag = args.fragmentLen
else:
    SPINEgene.maxfrag = args.oligoLen - 62 - 8- args.overlap # 62 allows for cutsites and barcodes (for AarI 2*(7+4))

#adjust primer primerBuffer
SPINEgene.primerBuffer += args.overlap

#SPINEgene.restrict_seq = args.restrictionSeq
if args.mutationType == 'DIS':
    SPINEgene.usage = None
else:
    if args.usage:
        SPINEgene.usage = args.usage

    

OLS = addgene(args.wDir+'/'+args.geneFile)

if args.matchSequences == 'match':
    align_genevariation(OLS)

if args.mutationType == 'DIS':
    generate_DIS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'DMS':
    generate_DMS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'S_DEL':
    generate_S_DEL_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'S_INS':
    generate_S_INS_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'allmut':
    generate_allmut_fragments(OLS, args.overlap, args.wDir)
elif args.mutationType == 'allmut_noCys':
    generate_allmut_noCys_fragments(OLS, args.overlap, args.wDir)

post_qc(OLS)
print_all(OLS, args.wDir)