-
Notifications
You must be signed in to change notification settings - Fork 15
search_primer_pair finding reverse complement sequences #39
Description
Hi,
I just tried the function search_primer_pair. It is supposed to search for the forward primer by 5’-3’ on plus strand and for the reverse primer by 5’-3’ on minus strand. However, I got results for sequences that were reversed on GenBank, hence the outliers in the tree below.
search_primer_pair( GTGTTAAACCTTAAAGTAGCG, ATCCAACATCGAGGTCAC, name = NULL, num_aligns = 500, num_permutations = 25, simplify = TRUE, clustal_options = list(exec = "clustalo", quiet = TRUE, original.ordering = TRUE), distance_options = list(model = "N", pairwise.deletion = T), api_key = "xxxxxxxx", .parallel = FALSE, .progress = "none" )
It's actually a good thing that the function was able to find them, but it would be great if it could detect this issue and reverse complement them in order to have them in the right direction in the alignment.
Thanks for this package. It's going to be very useful for my research.
Cheers
